ID: 1058155747

View in Genome Browser
Species Human (GRCh38)
Location 9:101512782-101512804
Sequence TCCTCTCCGTGGATTTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058155741_1058155747 15 Left 1058155741 9:101512744-101512766 CCTGACAATAGCTTTCATCAATG 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1058155747 9:101512782-101512804 TCCTCTCCGTGGATTTAAGGGGG No data
1058155740_1058155747 16 Left 1058155740 9:101512743-101512765 CCCTGACAATAGCTTTCATCAAT 0: 1
1: 0
2: 0
3: 23
4: 243
Right 1058155747 9:101512782-101512804 TCCTCTCCGTGGATTTAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058155747 Original CRISPR TCCTCTCCGTGGATTTAAGG GGG Intronic
No off target data available for this crispr