ID: 1058156004

View in Genome Browser
Species Human (GRCh38)
Location 9:101515535-101515557
Sequence CTCAGTTTACATGGTAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058156001_1058156004 -7 Left 1058156001 9:101515519-101515541 CCAAGTATAGGCACTCCTCAGTT 0: 1
1: 0
2: 1
3: 34
4: 426
Right 1058156004 9:101515535-101515557 CTCAGTTTACATGGTAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058156004 Original CRISPR CTCAGTTTACATGGTAATGC AGG Intronic
No off target data available for this crispr