ID: 1058157125

View in Genome Browser
Species Human (GRCh38)
Location 9:101528410-101528432
Sequence TAAAACTGGATTTCAGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 1, 2: 3, 3: 14, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058157125_1058157130 21 Left 1058157125 9:101528410-101528432 CCCTCAGCTGAAATCCAGTTTTA 0: 1
1: 1
2: 3
3: 14
4: 206
Right 1058157130 9:101528454-101528476 TGATGGTCATGCCATGCTTCTGG No data
1058157125_1058157131 27 Left 1058157125 9:101528410-101528432 CCCTCAGCTGAAATCCAGTTTTA 0: 1
1: 1
2: 3
3: 14
4: 206
Right 1058157131 9:101528460-101528482 TCATGCCATGCTTCTGGAAATGG No data
1058157125_1058157129 4 Left 1058157125 9:101528410-101528432 CCCTCAGCTGAAATCCAGTTTTA 0: 1
1: 1
2: 3
3: 14
4: 206
Right 1058157129 9:101528437-101528459 TCAGCTTGCTTTCTGAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058157125 Original CRISPR TAAAACTGGATTTCAGCTGA GGG (reversed) Intronic
902352978 1:15872240-15872262 AAAAAGTGCATTTCAGCTAAGGG + Intronic
905096047 1:35471850-35471872 TAAAATTGGTCTTCAGATGAAGG - Intronic
906071194 1:43017789-43017811 TAATACTGAATTTTATCTGAGGG + Intergenic
906934944 1:50206348-50206370 TAAAACTTGATTTCAGCTCATGG - Intergenic
908795094 1:67823339-67823361 TAAAAATAGTTTTCAGCTAATGG - Intronic
908802827 1:67897776-67897798 AAAATCTAGAGTTCAGCTGAAGG + Intergenic
909332881 1:74435793-74435815 AAAAACTGATCTTCAGCTGATGG + Intronic
909414907 1:75394894-75394916 TAAAAGTGCATCTCAGCAGAGGG - Intronic
909480535 1:76125196-76125218 TAAATATGGATTCCAGCAGATGG - Intronic
909537979 1:76759769-76759791 GAAAAATGGATTTCTTCTGAAGG + Intergenic
910577480 1:88782062-88782084 AAAAACTGGATTACTGATGATGG - Intronic
910694692 1:89999542-89999564 TATAACTGGTTCTCATCTGAGGG + Intronic
910696478 1:90023577-90023599 TAAAATTGGATTTCAATTGAGGG - Intronic
911165530 1:94721024-94721046 TAAAAGTGAACCTCAGCTGAGGG + Intergenic
911741275 1:101388742-101388764 TAAATCTGAATGTCAGGTGAAGG + Intergenic
911879686 1:103220542-103220564 TAAAACGGGAGCTCAGTTGACGG - Intergenic
912634722 1:111281268-111281290 TAAAATTCTATTTCAGCTAAAGG + Intergenic
915873236 1:159584671-159584693 TATAACTGGAGATCACCTGAGGG - Intergenic
916173624 1:162020484-162020506 TAAACCTGGATTGTAGCAGAAGG - Intronic
921272133 1:213481559-213481581 TAAAATTTTATTTCACCTGAGGG + Intergenic
922035532 1:221844404-221844426 TAATTCTGGATTTGAGATGAGGG + Intergenic
922381557 1:225033937-225033959 TAAAGCTGTTTATCAGCTGAAGG + Intronic
922599533 1:226839023-226839045 TAAAACTGGATTTTACAAGAAGG + Intergenic
923182276 1:231530935-231530957 AAAAACTGTAGTTCAGCAGACGG - Intronic
924141234 1:241025913-241025935 TTAGACTGTATTTCACCTGAGGG - Intronic
1064978323 10:21141921-21141943 TAGAACAGGAGTTCTGCTGAAGG - Intronic
1066513751 10:36132005-36132027 GGAAACTGGATTTGAGCTGGTGG + Intergenic
1067452229 10:46388870-46388892 TAAATCTGGATTTGAGCGGTGGG - Intronic
1067585008 10:47470885-47470907 TAAATCTGGATTTGAGCGGTGGG + Intronic
1074928706 10:118101262-118101284 TAACACTGAATTTCATGTGATGG - Intergenic
1075059086 10:119242137-119242159 TAAGAATTGTTTTCAGCTGAAGG - Intronic
1075432057 10:122393922-122393944 TCAAACTGCATTTCAGTTCATGG - Intronic
1076868797 10:133182684-133182706 AAAAACTGGATTTCAGTAGAAGG - Intronic
1077486655 11:2841826-2841848 TAAAAGTGGATGTCAGCAGCAGG + Intronic
1077843888 11:6003686-6003708 AAAAAATGGATTTCAGGTGGGGG - Intergenic
1078189289 11:9078250-9078272 TAAGACTTGATTGCAGGTGAGGG - Intronic
1078272859 11:9812627-9812649 TAAAACTGGCTTTCACTTGCCGG + Exonic
1078300238 11:10122312-10122334 TAAAAATGTATTCCAACTGATGG + Intronic
1078972693 11:16432536-16432558 TAAAACTGGGTTTCTGATTACGG - Intronic
1079487916 11:20954745-20954767 TCAAAGTGGATTTGACCTGAAGG + Intronic
1080289309 11:30652998-30653020 TAAAACTGGATTTCAGAAACAGG - Intergenic
1080604585 11:33854570-33854592 TAAAACTTGATTTGAGAAGAAGG - Intergenic
1082096287 11:48132868-48132890 GAATACTGCATTTCATCTGAGGG - Intronic
1082740130 11:56901673-56901695 TAAAATTGGATGTCAGGTGTGGG + Intergenic
1084793381 11:71489156-71489178 AACAACATGATTTCAGCTGATGG + Intronic
1084884641 11:72195732-72195754 TGGAACTGGACTTCAGGTGAGGG + Exonic
1086617236 11:88836320-88836342 CAAAAATAGAATTCAGCTGATGG + Intronic
1086962870 11:92997784-92997806 TTAAAATTGTTTTCAGCTGAAGG - Intergenic
1091044060 11:132310195-132310217 TACCACTGGAATTCTGCTGAGGG - Exonic
1091107461 11:132936172-132936194 GAAATCTGCATTTCAGTTGAAGG - Intronic
1095916861 12:47488498-47488520 TTAAACTTGCTTTCAGTTGATGG + Intergenic
1097887721 12:64746549-64746571 TAAAAGTGGGTTTCATCTGCAGG - Intronic
1101112832 12:101503081-101503103 TAAACCTGTATTTCAGGTGCAGG + Intergenic
1102354700 12:112222993-112223015 TAAGCCTGGATCTCAGCTGAGGG + Intronic
1103111591 12:118284580-118284602 TAAAACTGAATTGAAGGTGATGG + Intronic
1104548552 12:129734017-129734039 TGATACTGGATTGCAGCTGTGGG - Intronic
1108006766 13:45955052-45955074 CACAACTGGATTCCAGCTGCTGG - Intronic
1108538655 13:51414123-51414145 TACAACTGGATTTCAGCCTGTGG - Intronic
1109511831 13:63386812-63386834 TGAAACTGGATTGCTGCTGTTGG - Intergenic
1110249549 13:73366295-73366317 TAAAGCTGGAATTTAGTTGAAGG + Intergenic
1110722313 13:78777735-78777757 TAAAACTGGATTTCAATTGTTGG + Intergenic
1113499501 13:110761954-110761976 TACAACTGTATTTCAGGGGAGGG + Intergenic
1115471172 14:33770107-33770129 TAAATCTGGATCTCAGGTGGTGG - Intronic
1121052846 14:90830790-90830812 TAAAATTGTACTTCAGGTGAAGG - Intergenic
1121615073 14:95308317-95308339 GAAAACTGGATCCCAGCTAAAGG - Intronic
1125108402 15:36001651-36001673 TAAAAATGGATTTGCACTGAAGG - Intergenic
1125248844 15:37676211-37676233 TAAAATTGGCCTTGAGCTGATGG + Intergenic
1126255682 15:46622558-46622580 TAAAACTTGATTGCAGATGTTGG + Intergenic
1126370974 15:47946737-47946759 TATAAATGTATTGCAGCTGATGG - Intergenic
1127261241 15:57327886-57327908 TGAAACTGAAATTCATCTGAAGG - Intergenic
1128802849 15:70507941-70507963 TAAAAGTGAATTTCAACAGAGGG + Intergenic
1128981467 15:72190476-72190498 TAAAACTGGATCTCCACTGCTGG + Intronic
1140506051 16:75473520-75473542 AAAAAATGATTTTCAGCTGAAGG + Exonic
1140513473 16:75525275-75525297 TAAAAATGATTTTCAGCTTAAGG + Intergenic
1143385516 17:6527745-6527767 CAAAACTGGATTCCAGCAGGAGG - Intronic
1143564126 17:7711420-7711442 TTAGAATGGCTTTCAGCTGAGGG + Intergenic
1148847654 17:50538696-50538718 TTAAACTGCATTTCAGATGCAGG + Intronic
1151369298 17:73637823-73637845 TAAAGTTGGAGTTCAGCTGATGG + Intronic
1153133699 18:1887868-1887890 TAATAGTAGATTACAGCTGAAGG + Intergenic
1153309923 18:3667859-3667881 TAAAAATGATTTTGAGCTGAAGG + Intronic
1155343737 18:24838384-24838406 TGGAAATGCATTTCAGCTGAGGG - Intergenic
1156540749 18:37907460-37907482 AAAAACTGGAATTGAGCAGATGG - Intergenic
1157536463 18:48462034-48462056 TAATACTCCATTTCAGCTGCTGG + Intergenic
1159482410 18:69007193-69007215 AAGAACTGGATTTCACCTTAAGG - Intronic
1159958077 18:74533900-74533922 GAAAAGAGGACTTCAGCTGAGGG - Intergenic
1160278353 18:77461450-77461472 TAACAGTGGATTCCAGTTGAAGG - Intergenic
1162700438 19:12511158-12511180 TAAATCTGGATTTTACTTGAGGG + Intronic
1162960052 19:14120346-14120368 CAGACCTGGATTGCAGCTGATGG + Exonic
1163031191 19:14545339-14545361 GGAAATGGGATTTCAGCTGAGGG - Intronic
926412437 2:12618162-12618184 TGAAACTGGCTCTCAGGTGAGGG - Intergenic
926458378 2:13097469-13097491 TAATACTGGATTCCATCAGATGG + Intergenic
927437194 2:23076885-23076907 TAAAAATAGATCTCAGCAGAGGG + Intergenic
927632134 2:24783764-24783786 TAAGGCTGGATTTTAGCTGAAGG - Intergenic
929846831 2:45539279-45539301 TGAAGCTGACTTTCAGCTGAGGG + Intronic
931559157 2:63538203-63538225 AAATACTTGATTACAGCTGAGGG - Intronic
931991937 2:67799144-67799166 TAAAACTGGATTCTAGCAAAGGG + Intergenic
933291583 2:80444196-80444218 TAAAACTGAATTTTAGATCAAGG + Intronic
935064910 2:99638986-99639008 TAAAACTGAATTTCACCCGGAGG + Intronic
939662489 2:144907422-144907444 TAAATATGGCTTTCAACTGAAGG - Intergenic
940587124 2:155667091-155667113 TAAAAATTGATTTTACCTGATGG - Intergenic
941881836 2:170488664-170488686 TAAAACTGGTTTTCTGCAGTGGG + Intronic
942689537 2:178570957-178570979 TAAAACTGGCTTTCATCCAACGG + Exonic
943071391 2:183144603-183144625 TAAGACTGGATTAAAGCAGAGGG - Intronic
943840939 2:192579789-192579811 AAAACCTGGATTTGAGATGATGG - Intergenic
944162274 2:196676996-196677018 TAAAAATTGATTTCCCCTGAAGG + Intronic
945781313 2:214176110-214176132 TAAACCTGTATTTAATCTGAAGG - Intronic
946093438 2:217250690-217250712 TAAAACTGGGTTTAAAATGAAGG + Intergenic
947756240 2:232567429-232567451 TACAACTGGGTTTCTGCAGATGG - Intronic
948171882 2:235910369-235910391 TAAAACTGGCTTTATGCTAAAGG + Intronic
948294603 2:236851222-236851244 TGCAACTGGATTTCAGAGGAAGG - Intergenic
1169125240 20:3122571-3122593 TAAATCTAGATATCAGCTGATGG - Exonic
1171564644 20:26169844-26169866 TATAATTTGATTTCAGCTTAAGG + Intergenic
1172910182 20:38402944-38402966 TGAAACTGGAGTTCAGCAGGAGG + Intergenic
1172966763 20:38841210-38841232 TACAACTGGATTGTGGCTGATGG - Intronic
1177466549 21:21489976-21489998 TAAAATTAGATTTAAACTGAGGG - Intronic
1177581057 21:23021969-23021991 TGAAAGTGGATTGCAGCTGTAGG - Intergenic
1179244134 21:39615372-39615394 TAATTCTGGTTTTCAACTGAAGG - Intronic
1179342559 21:40526373-40526395 TAAAAGTGGGTTTCATTTGAGGG - Intronic
1179609074 21:42537472-42537494 TAAATCTGGTTCTCAGCTGGGGG + Intronic
1181825552 22:25512623-25512645 GGAAACTGGATTTCAGATGCAGG - Intergenic
949295982 3:2523564-2523586 CAAGTCTGGATTTGAGCTGAAGG + Intronic
949333940 3:2953055-2953077 CAAAACTGGAATTCATCTGTAGG + Intronic
952322166 3:32288181-32288203 TAACACAGGATTTTAGATGATGG + Intronic
956488066 3:69742175-69742197 TAAAACTGGTTCTCAGTTGGAGG + Intronic
957154689 3:76533059-76533081 TAAAAGAGGATTTCATCAGAGGG + Intronic
957255647 3:77833345-77833367 TAAAACTGGATTTTAATTGAAGG + Intergenic
961250246 3:125497340-125497362 TGAAACTGGGTTTCAGCTGAAGG - Exonic
963559675 3:146847611-146847633 TAAAACTTGTGTTCAGTTGAAGG - Intergenic
963639197 3:147837747-147837769 TGAAAGTGGAAATCAGCTGATGG - Intergenic
964464392 3:156974493-156974515 AAAAACTGAATTGCAGCTGGAGG - Intronic
965164355 3:165176291-165176313 TAAAAATGAATTGCAGCTGAAGG - Intergenic
965245849 3:166267351-166267373 AAAAACTGGATTTCAGATATAGG - Intergenic
967439249 3:189488158-189488180 TAACACTATATTTCAGATGATGG - Intergenic
969104757 4:4797257-4797279 TAAAACTGGTTTTCAGATATTGG + Intergenic
970268480 4:14316928-14316950 TTAAACTGCATTTCAGAAGAAGG - Intergenic
970725213 4:19035986-19036008 TAAAACTGGTTTTCCTCTAAAGG + Intergenic
971376827 4:26062381-26062403 TATAACTGGTATTCATCTGAGGG + Intergenic
971986500 4:33831716-33831738 TATAATTTGATTTCAGCTTAAGG - Intergenic
974687510 4:65249065-65249087 TAAAACTGGGTTTCAGCTGAGGG + Intergenic
975788293 4:77918327-77918349 TTAAATTGGTTTTCAGCTCAGGG + Intronic
976140806 4:81989540-81989562 TAAAACTCATTTTGAGCTGAGGG - Intronic
978444505 4:108767672-108767694 TAAAAGTTAATTTGAGCTGAAGG + Intergenic
980640421 4:135570297-135570319 TGAGCCAGGATTTCAGCTGAGGG - Intergenic
981008739 4:139902717-139902739 GAAAAATGAATTTCAGCTGGTGG - Intronic
981774561 4:148350583-148350605 TAAAAATGGATTTGAGGAGATGG - Intronic
983297839 4:165888953-165888975 TAAAACCAGCTTTCAACTGAGGG - Intronic
984704219 4:182835939-182835961 AAAATCTGGATTTCAGCAAAAGG - Intergenic
985797524 5:1974044-1974066 CCACACTGGCTTTCAGCTGAGGG + Intergenic
989551669 5:42742976-42742998 TAAAACTTGTTTTAAGCTGGAGG + Intergenic
990334914 5:54763184-54763206 GAAATCTTGATGTCAGCTGAGGG + Intergenic
991117671 5:62972741-62972763 GAAAACTTGATTTGAGATGATGG - Intergenic
991552515 5:67855976-67855998 TAAAAAGGGGTTTCAGCTGTTGG - Intergenic
992279894 5:75163463-75163485 AAAAGCTGAATTGCAGCTGAAGG + Intronic
993159869 5:84276258-84276280 TAAAACTGGATTGCAGCAAGAGG - Intronic
994601611 5:101912476-101912498 TAAAATTGTTTATCAGCTGAAGG + Intergenic
998012901 5:138709496-138709518 GAAGGCAGGATTTCAGCTGAAGG + Intronic
999458871 5:151740569-151740591 GAAACTTGGATTTCAGCTGGGGG + Intergenic
1000163572 5:158625382-158625404 AAAAATTGGATTGCAGGTGAAGG - Intergenic
1000392549 5:160740160-160740182 TAAAACTGGATTGCCTCTGGGGG - Intronic
1000425457 5:161085218-161085240 TAAAACAGGATTTCAGGGGTGGG - Intergenic
1005459155 6:26051634-26051656 TAAAAGTTATTTTCAGCTGAAGG + Intergenic
1006089878 6:31621989-31622011 TAAAACAGTATTTCATCTGGAGG + Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007922080 6:45619485-45619507 GACACCTGGATTTCAGCAGAGGG - Intronic
1010782057 6:79954880-79954902 TAAAATTGCATGTCAGATGATGG + Intergenic
1011767804 6:90642643-90642665 TTAAGCTGGATTTCAGGTGATGG - Intergenic
1011986473 6:93453205-93453227 TAAAACTGAAGTTTAGATGAAGG - Intergenic
1012551255 6:100466386-100466408 CAAAACTGGAATCCAGCTAATGG + Intergenic
1013642476 6:112099465-112099487 TAATAATGAATATCAGCTGAAGG - Intronic
1015151631 6:130045699-130045721 TAAAAATTTATTTCAGCTGGAGG + Intronic
1016616328 6:146052651-146052673 AGAAAGTGGATTTCAGCTGGAGG - Intronic
1016878836 6:148889984-148890006 TAAAACTGGATTTACTCTAAAGG - Intronic
1018880017 6:167868371-167868393 TAAAATTTGATTCCAGATGAGGG - Intronic
1019221991 6:170480239-170480261 AGAAACTGCATTCCAGCTGAAGG + Intergenic
1021699981 7:23308688-23308710 TAAAACTGGAACTCAGATGAGGG + Intronic
1023759880 7:43455449-43455471 TAAAACTGGCTTTAATCTGAGGG + Intronic
1024085386 7:45888254-45888276 TAGAACTGGACTTTAACTGAGGG + Intergenic
1024182988 7:46916379-46916401 CAACAGTGGATTGCAGCTGAAGG - Intergenic
1024511582 7:50208375-50208397 AAAAGATGGACTTCAGCTGAGGG + Intergenic
1030040382 7:105444372-105444394 TAACAATGGATTACAGCTGAAGG + Intronic
1030192967 7:106827850-106827872 TGAAAGTTGATTCCAGCTGAAGG + Intergenic
1031692501 7:124806989-124807011 TACAAATGAATTTCAGTTGAAGG + Intergenic
1033319350 7:140325904-140325926 CAAAGCTGGATTCCAGATGATGG + Intronic
1035107199 7:156451280-156451302 TAAAAGGGGATTTTAACTGATGG - Intergenic
1036025926 8:4909165-4909187 TAAGAGTGGATTACAGCAGAAGG - Intronic
1036949142 8:13124316-13124338 TGAAACTGGATTGCAGGAGAGGG + Intronic
1037325676 8:17687665-17687687 TAAGGCTGGATCACAGCTGATGG - Intronic
1037575559 8:20198664-20198686 TTAAAAAGGATTTCAGATGAAGG + Intronic
1038118841 8:24589132-24589154 TAACTGTGGATTCCAGCTGAAGG - Intergenic
1039341936 8:36659980-36660002 TAACAGTGGATCTCAGGTGAGGG + Intergenic
1039342096 8:36661801-36661823 TAACAGTGGATCTCAGGTGAGGG + Intergenic
1041735069 8:61102165-61102187 TAAATCTGTAGATCAGCTGAAGG + Intronic
1041735819 8:61109387-61109409 TAAATCAGAATTTCAGATGAAGG + Intronic
1042306102 8:67334939-67334961 TAAAACTGGATTTATGCTGATGG + Intronic
1042378493 8:68083519-68083541 TAATACTGGTTTACAGATGATGG + Intronic
1043752241 8:83952350-83952372 TAAGAATGGATTTCAGCGGGAGG + Intergenic
1044367473 8:91366120-91366142 TAAAGTTATATTTCAGCTGAAGG + Intronic
1046078450 8:109340038-109340060 TAGAGCTGGATTTCAACTCAGGG + Intronic
1046330356 8:112706612-112706634 TAGAACTGGAGTTCAGATGCAGG + Intronic
1047952647 8:129947917-129947939 TGATTCTGGAGTTCAGCTGAAGG + Intronic
1050401716 9:5262931-5262953 TAAAAATGGATTAAAGATGACGG - Intergenic
1050745261 9:8868700-8868722 TAAAAATGGAATTCAGCCAAAGG - Intronic
1051520198 9:17978913-17978935 TAAAGCTGTATTTCAAATGAAGG - Intergenic
1051589470 9:18762012-18762034 TAAAACAGGCATCCAGCTGATGG - Intronic
1052206106 9:25842650-25842672 TAAAATTGGCTTTCAGCTATAGG - Intergenic
1054944247 9:70778149-70778171 AAAAACTGGATCTAAGCTGAGGG - Intronic
1055501326 9:76905512-76905534 TAGAACTGTACTTCAGCTGGAGG - Intronic
1057792262 9:98132131-98132153 TGACACTGGCTCTCAGCTGAGGG + Intronic
1058157125 9:101528410-101528432 TAAAACTGGATTTCAGCTGAGGG - Intronic
1058355992 9:104083990-104084012 TAAAAATGGATTTCACATTATGG - Intergenic
1060431669 9:123556111-123556133 AAGAACTGGCTTTAAGCTGAAGG + Intronic
1187675522 X:21712346-21712368 TTAATCTGGATTTCAGGTGCAGG - Intronic
1187760308 X:22576584-22576606 TAAAAGTGGATTTGAGGTCAAGG - Intergenic
1188447463 X:30271063-30271085 TAATGCTGGTTTTCAGCTGTTGG - Intergenic
1189610298 X:42726088-42726110 TAAAAGTGGAATTGAGATGATGG + Intergenic
1194722181 X:97353347-97353369 TAAAAATTAATTTCAGCTGTTGG + Intronic
1196937559 X:120744791-120744813 TGATACTGGATTTCAGTTTATGG - Intergenic
1197185177 X:123578076-123578098 TAAAATTGCTTATCAGCTGAAGG - Intergenic
1197386566 X:125810638-125810660 TTAAACTGGAAGTAAGCTGAAGG - Intergenic
1198759266 X:140014547-140014569 TAATATAGGATTTCACCTGAAGG + Intergenic
1198779472 X:140219030-140219052 TAATATAGGATTTCACCTGAAGG - Intergenic
1199759773 X:150896511-150896533 TATCACTGGCTTTCAGATGAGGG - Intronic
1201505121 Y:14689978-14690000 TAAGACTGGATTAGAACTGAAGG + Intronic
1201704987 Y:16927398-16927420 TAAAACTGGATTTGAGTAAATGG - Intergenic
1202190207 Y:22234663-22234685 TAAAACTTGTGTTCAGCTCAAGG + Intergenic