ID: 1058161459

View in Genome Browser
Species Human (GRCh38)
Location 9:101574541-101574563
Sequence TCCAGATTGTCCCCTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058161459_1058161464 24 Left 1058161459 9:101574541-101574563 CCAGGAGAAGGGGACAATCTGGA 0: 1
1: 0
2: 3
3: 23
4: 230
Right 1058161464 9:101574588-101574610 ATAAAGTCTTTATGTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058161459 Original CRISPR TCCAGATTGTCCCCTTCTCC TGG (reversed) Intronic
900154933 1:1200149-1200171 TCCAGCTTGGCGCCGTCTCCAGG - Intergenic
901130280 1:6958199-6958221 TCCCGATTTGCACCTTCTCCAGG - Intronic
901257316 1:7841349-7841371 ACCAGATTCTCCCCTTTCCCAGG + Intronic
901395682 1:8979709-8979731 ACCTGGTTGTCCCCTGCTCCAGG + Intergenic
901877624 1:12175791-12175813 TCCTGATTCTGCCCTTCTCCAGG + Intronic
902237969 1:15069770-15069792 TCCAGAAGGTGCCATTCTCCAGG + Intronic
903473939 1:23606668-23606690 TCCAGACTGTACTCTTCTCTGGG + Intronic
903997725 1:27318206-27318228 TCCAGTTAGTCCCCTTCTCAAGG + Intergenic
904071274 1:27799691-27799713 GCCAGATGGTCTCCATCTCCTGG + Intronic
904880645 1:33694243-33694265 TCCCCGTTGTCCCCTTCCCCAGG - Intronic
905562357 1:38937522-38937544 TCCAGATTCTCAGCTTCTGCAGG - Intronic
906727495 1:48054758-48054780 TCCAGATGCTCCCCAGCTCCAGG + Intergenic
907834816 1:58098759-58098781 TATAGATTGCCACCTTCTCCGGG - Intronic
908595202 1:65681220-65681242 TCCATATTGTTCCCATATCCTGG - Intergenic
912709952 1:111943078-111943100 TCCTGGGTGTCCCCTTCTCCCGG - Intronic
913217847 1:116635483-116635505 CACAGATTGTCCACTTTTCCAGG + Intronic
916886833 1:169077766-169077788 TCTAGAGTGTACCTTTCTCCAGG + Intergenic
918214015 1:182377204-182377226 TCCAGGTTCTTCCCTTCTCTTGG - Intergenic
919473070 1:198002743-198002765 TCAAGATTTTCCCCTTTTTCAGG - Intergenic
920177843 1:204114266-204114288 TGCAGCCTGTCCCCTTCTCTTGG + Intronic
922039465 1:221882391-221882413 TACAGCATGCCCCCTTCTCCAGG - Intergenic
922201498 1:223405292-223405314 TCCTTATTGTACCTTTCTCCTGG - Intergenic
922965339 1:229686123-229686145 ATCAGATTCTCCCCTTCACCAGG + Intergenic
923330733 1:232922111-232922133 TCTAGATTGCCACCTTCTCATGG + Intergenic
1063925970 10:10977863-10977885 TCTTGATTGTCCCCATCTCCTGG + Intergenic
1064221422 10:13444079-13444101 TGCAAATTGTCCCCAGCTCCTGG + Intronic
1066460084 10:35605542-35605564 TCCAGAATGTCCCAGGCTCCAGG - Exonic
1066592466 10:37010346-37010368 TCCACATTGTCACCTCCTGCTGG - Intergenic
1067686627 10:48469708-48469730 TCCAGATTGTACCAAACTCCTGG + Intronic
1069598493 10:69687912-69687934 TCCACTTTTTCCCTTTCTCCTGG - Intronic
1073000524 10:100282137-100282159 TCCAAATTCTCCCTCTCTCCTGG + Intronic
1075662735 10:124209483-124209505 TCCTCTTTGCCCCCTTCTCCAGG + Intergenic
1075880476 10:125846645-125846667 TCCAAATTGTCCCCTTTTATAGG + Intronic
1076412341 10:130261342-130261364 TGCAGAGTGGCCCGTTCTCCAGG + Intergenic
1076440266 10:130476660-130476682 TGCAGATGGTCACCTTCTCCTGG + Intergenic
1081462116 11:43281492-43281514 TCCAGCTCCTCCCCTTCTTCGGG + Intergenic
1081943576 11:46966968-46966990 TCCAGATTTTTGCCTTCTCGGGG + Intronic
1083529861 11:63409895-63409917 TCCTGATTGTTCCCTTCATCTGG - Exonic
1084371107 11:68744117-68744139 TCCTGATTGTCTCCCTGTCCAGG - Intronic
1085122870 11:73978401-73978423 TCCAGTTTTTCTCCATCTCCTGG - Exonic
1085138975 11:74122395-74122417 TCCTGATTTTCCTTTTCTCCAGG - Intronic
1085526272 11:77166098-77166120 TCCAGCTGGTCCACTCCTCCAGG + Exonic
1085895887 11:80639025-80639047 TCCACATTGTCACCTCCTGCTGG + Intergenic
1086079615 11:82889677-82889699 TCCACATTGTTCCCTTTGCCTGG - Intronic
1087252364 11:95917396-95917418 TCCAGGTTATCTCCTTCCCCTGG + Intronic
1089490491 11:118880428-118880450 TCCACCCTGTCCCCCTCTCCAGG + Intergenic
1089773142 11:120817473-120817495 TGCTGATTCTCCCCTGCTCCAGG + Intronic
1090035005 11:123241647-123241669 TCCAGATTGTCCCCCTGCTCTGG - Intergenic
1090359830 11:126164599-126164621 GCCAGATTTTCCTCCTCTCCAGG - Intergenic
1091478770 12:804706-804728 TCCCCATTGTCCCCTTTCCCTGG + Intronic
1094375644 12:29784526-29784548 TCCAGGGAGACCCCTTCTCCTGG - Intronic
1094414149 12:30200870-30200892 TCCAGGGAGACCCCTTCTCCTGG + Intergenic
1096849656 12:54427430-54427452 TCCAGCTTTGGCCCTTCTCCAGG - Intergenic
1097061925 12:56291658-56291680 CCCAGATTCTCCCCTAATCCTGG + Intronic
1097159889 12:57038719-57038741 TCCAGACTCTCACCTTCCCCGGG + Intronic
1097328964 12:58312442-58312464 GCCAGAATCTCCCCTACTCCTGG - Intergenic
1098435355 12:70462973-70462995 TTTTGATTGTCACCTTCTCCTGG + Intergenic
1098917208 12:76269863-76269885 TCCATATTGTCCCCATCCCCAGG - Intergenic
1100407651 12:94285275-94285297 GCCAGATTCTCCCCTTGCCCAGG + Intronic
1104967832 12:132517244-132517266 TCCTGAGTGGCCCCTTCCCCTGG - Intronic
1105020480 12:132813393-132813415 TACAGATTCTCCCCTGCCCCTGG - Exonic
1110392616 13:74993052-74993074 TTCTGACTGTTCCCTTCTCCAGG - Intergenic
1111318596 13:86593988-86594010 GGCAGATTGCCCCCTTCTCTGGG - Intergenic
1113467197 13:110520640-110520662 GTCAGAATGTCCCCTTCCCCAGG - Intergenic
1115660710 14:35491800-35491822 ATCATATTCTCCCCTTCTCCAGG + Intergenic
1116992147 14:51287816-51287838 TTCAGATTGAGCCCTTTTCCTGG + Intergenic
1117244818 14:53874359-53874381 CACAGATTGTTTCCTTCTCCAGG + Intergenic
1117314158 14:54557647-54557669 TCCAGCTCATTCCCTTCTCCAGG - Intergenic
1119750586 14:77074821-77074843 CCCTCATTGTCCCCATCTCCTGG - Intergenic
1121001581 14:90455096-90455118 TCCTGACTGTCCCCCTCACCAGG - Intergenic
1122202398 14:100130525-100130547 GCCACTTTGTCGCCTTCTCCTGG + Intronic
1124180418 15:27467981-27468003 TGCAAATCGTCCCCTTCTCCAGG + Intronic
1127260413 15:57323097-57323119 TCCAAGTTGCCCCCATCTCCTGG - Intergenic
1129170424 15:73804230-73804252 TCCAGTGGGACCCCTTCTCCTGG + Intergenic
1132872787 16:2123181-2123203 TCCAGGCTGGCTCCTTCTCCCGG + Intronic
1132994321 16:2815150-2815172 GCCTCATTGTTCCCTTCTCCTGG - Intergenic
1132996707 16:2827276-2827298 GCCTCATTGTTCCCTTCTCCTGG + Intergenic
1134551875 16:15142360-15142382 TCCAGGCTGGCTCCTTCTCCCGG + Intergenic
1134592074 16:15462621-15462643 TTCAGGCTGTTCCCTTCTCCAGG - Intronic
1134868506 16:17630427-17630449 TTCAGATTTTCAGCTTCTCCTGG - Intergenic
1136227770 16:28870467-28870489 TCCAATTTGTCCCCATATCCTGG - Intronic
1137588030 16:49676004-49676026 CCCACAGTGCCCCCTTCTCCAGG + Intronic
1138481369 16:57305494-57305516 TCCAGATTCCCCCATTCCCCTGG - Intergenic
1140491293 16:75338153-75338175 TCCAAATTCTCCCTGTCTCCTGG - Intronic
1141633334 16:85301001-85301023 TCCAGTGTGTTCCCTCCTCCAGG + Intergenic
1143446458 17:7012879-7012901 TTCAGTCTGTCTCCTTCTCCGGG - Intronic
1143720811 17:8807782-8807804 TCCATCTTCTCCCATTCTCCAGG - Intronic
1146655202 17:34630898-34630920 TCCAGATTCCCTCCTTCCCCTGG + Intronic
1146658562 17:34649551-34649573 TCCAGTTAGAGCCCTTCTCCAGG - Intergenic
1146747561 17:35345778-35345800 TTCAGATTCTCCCCTCATCCCGG - Intergenic
1147472896 17:40680474-40680496 CCCAGATTTTTCACTTCTCCTGG + Intergenic
1150557932 17:66270143-66270165 TCCTCATTTGCCCCTTCTCCCGG + Intergenic
1150744696 17:67807074-67807096 TCCCCATTCTCTCCTTCTCCCGG + Intergenic
1152030155 17:77837321-77837343 TGCAGATGGCCACCTTCTCCTGG + Intergenic
1152147490 17:78577064-78577086 TCCAGACTCTTCCCTGCTCCTGG - Intronic
1152261146 17:79268026-79268048 TGCAAATTTTCCCCTTCTCCAGG + Intronic
1152266921 17:79300511-79300533 CACAGATTCTCCCCTCCTCCAGG - Intronic
1152798469 17:82320282-82320304 TCCACACTGCCCCCTGCTCCTGG - Intergenic
1155085506 18:22454092-22454114 TCCACATTGTCCCCCTCACCGGG + Intergenic
1156050275 18:32924229-32924251 TCCAATTTGTCCCCTTATCCTGG + Intergenic
1157491825 18:48128922-48128944 ACCACATGGTCCCCTTCTCAGGG - Intronic
1158232189 18:55269325-55269347 TCCACAGTGTCACATTCTCCAGG + Intronic
1159368271 18:67498897-67498919 CCCAAATTATCCCCATCTCCTGG + Intergenic
1159564392 18:70032204-70032226 ACCAGATTGGCCCCATCTCATGG - Intronic
1160300235 18:77671594-77671616 GCCACGTTGCCCCCTTCTCCTGG - Intergenic
1161245405 19:3249114-3249136 TCCACGGTGTCCACTTCTCCAGG - Intronic
1161315065 19:3613865-3613887 TCCTGCTGGGCCCCTTCTCCTGG - Intronic
1161650946 19:5484547-5484569 TCCACCTTGCCCCCTCCTCCAGG + Intergenic
1162876216 19:13622858-13622880 TCTAAATTGGCTCCTTCTCCTGG + Intronic
1163437058 19:17302232-17302254 GCCACAATGTCCCCTTCTCCAGG - Intronic
1165858684 19:38895175-38895197 TCCAGCCTGTCCTCTCCTCCGGG + Intronic
1166085584 19:40472634-40472656 TCCATGTTGTCCACTTCCCCTGG - Exonic
1166132492 19:40754523-40754545 TCCAAAATGTCTCCTTTTCCTGG - Intronic
1166233224 19:41438068-41438090 TCCAGGCTGTACCCTTCTCAAGG - Intronic
1167231917 19:48290435-48290457 TCAAGCTTGGCCCTTTCTCCCGG + Intergenic
925675801 2:6360079-6360101 AACAGAATGTCTCCTTCTCCTGG + Intergenic
926122702 2:10253620-10253642 TCCCGTTTGTCTCCTACTCCTGG + Intergenic
926422334 2:12712433-12712455 TCCAGGATGTTCCCTTCACCTGG - Intergenic
929814631 2:45221155-45221177 GTCAAACTGTCCCCTTCTCCTGG - Intergenic
930729314 2:54712489-54712511 TCAAGACTGGCCTCTTCTCCTGG + Intergenic
931043374 2:58323147-58323169 ACCAGCTTCTTCCCTTCTCCTGG + Intergenic
931158061 2:59657831-59657853 TCCAGAGTCTCCCCTACTGCAGG + Intergenic
933567106 2:83963584-83963606 TTCAGATTGTCCATTTCTTCTGG + Intergenic
933739678 2:85523693-85523715 GCCAGAGTGTCACCTTCTCAGGG - Intergenic
934084233 2:88496617-88496639 GGCAGATTCTTCCCTTCTCCTGG - Intergenic
936862117 2:117030477-117030499 GGCAGATTGTCCCTTTCTCTGGG - Intergenic
938176179 2:129132524-129132546 TTTTGATTGTCACCTTCTCCTGG - Intergenic
938373073 2:130786018-130786040 TGCAGATGGTCACCTTCTCGTGG + Intergenic
938824104 2:134987947-134987969 TCCAGTTTTCCTCCTTCTCCAGG + Exonic
939908300 2:147946489-147946511 CCCACATTGTCCCCTTTTACTGG - Intronic
942111340 2:172685349-172685371 TCCATATTTTCCCTTTCTCCTGG + Intergenic
943286164 2:186004066-186004088 ACCAGAATGTCAGCTTCTCCTGG - Intergenic
943440441 2:187921494-187921516 TTTTGATTGTCACCTTCTCCAGG - Intergenic
945054831 2:205859411-205859433 GCCAGAATGTCCCCTCCTACAGG - Intergenic
945182445 2:207105620-207105642 TCCACATTCTACCCTTCTTCAGG - Intronic
947873609 2:233453640-233453662 TCCAGAACATCCTCTTCTCCTGG + Intronic
948703285 2:239774135-239774157 TTCAGCCTGGCCCCTTCTCCAGG - Intronic
1168844321 20:933366-933388 TCCATATTGTCCCCTTTGCCAGG - Intergenic
1171288269 20:23961601-23961623 TTTTGATTGTCACCTTCTCCAGG + Intergenic
1173072565 20:39783510-39783532 TCCAGATTGGCTCTTTATCCTGG + Intergenic
1173340748 20:42150506-42150528 TCCAGAGTGTTCCCTGCACCAGG - Intronic
1173585200 20:44177007-44177029 TCCAGAGTGACCCCTGCTCCAGG - Intronic
1175771274 20:61626143-61626165 TCTAGAATGTCCCCTTCCCAAGG - Intronic
1175880654 20:62256823-62256845 TCCAGAGCCGCCCCTTCTCCTGG + Intronic
1178596506 21:33958113-33958135 TCCAGCATTTCCCCTACTCCAGG - Intergenic
1181520567 22:23447058-23447080 TCCTGATGGTCCCCACCTCCAGG - Intergenic
1183091461 22:35525200-35525222 CCCAGACTGTCCCCAGCTCCTGG + Intergenic
1184160749 22:42695801-42695823 GTCTGATTCTCCCCTTCTCCTGG - Intronic
1184471415 22:44698267-44698289 ACCAGAGTGGCCCCTGCTCCAGG - Intronic
950335339 3:12188683-12188705 TCCAGATGGTCACTTTCTCTGGG + Intronic
950481787 3:13248537-13248559 TCCACACCATCCCCTTCTCCAGG + Intergenic
950738843 3:15033506-15033528 TCAGAATTGTCCCATTCTCCAGG + Intronic
952256398 3:31699262-31699284 TCAAGTTTGTCCCCTTCACATGG + Intronic
953231064 3:41065466-41065488 TCCAGACTGGCCCCTTCTGGAGG - Intergenic
954228405 3:49198360-49198382 TCCAGAATGCCTCATTCTCCTGG + Intergenic
955301272 3:57782242-57782264 TCCAGCATCTCCCCTTTTCCAGG + Intronic
956249259 3:67218599-67218621 TCTAGATTGTGCCCTACTCAAGG - Intergenic
956974218 3:74561471-74561493 TCAAGTTTATCCCCTTCTCAGGG + Intergenic
957939376 3:86986271-86986293 TCCACAGTGTCACCTTGTCCTGG + Intronic
960993055 3:123324229-123324251 CCCAGCATGTCCCCTTCTCCAGG + Intronic
961052379 3:123757737-123757759 TCCTTAATGTCCCCTCCTCCAGG - Intronic
961602225 3:128071105-128071127 TCCAGAGTGTGCCCCTCTGCCGG - Exonic
961611378 3:128142652-128142674 TCCATTTTCTCGCCTTCTCCAGG + Intronic
961801452 3:129453232-129453254 ACCACATTGTCCCCATCTGCTGG - Intronic
962271685 3:133982194-133982216 CCCAGATTGTTCCCTGGTCCAGG + Intronic
964931734 3:162033279-162033301 TTGAGAATGTCACCTTCTCCAGG + Intergenic
969178957 4:5422849-5422871 TTCAGATTGTCACCTTCTCCAGG - Intronic
969495088 4:7521925-7521947 TCCAGCTTGTCCCCTGCTTACGG - Intronic
969882252 4:10184653-10184675 TGCAGATGGGCCCCTTTTCCTGG + Intergenic
974632769 4:64515984-64516006 TCCTCATTTTCCCCTTCCCCTGG + Intergenic
979531391 4:121772390-121772412 TCCAGATTGATCCAGTCTCCAGG - Intergenic
980182158 4:129414481-129414503 TCCAGGGTCTCCCCTGCTCCAGG - Intergenic
983738136 4:171089618-171089640 TCCATCTTCTTCCCTTCTCCTGG - Intergenic
984957807 4:185063226-185063248 TCCACCTTTTCCCCTTCTTCAGG + Intergenic
985807756 5:2059583-2059605 TCCAGCTTGTCCTCTGCTGCAGG - Intergenic
989394266 5:40936676-40936698 TGCAGAGTGACCCCTTGTCCTGG + Intronic
990819285 5:59819009-59819031 CCCATATAATCCCCTTCTCCAGG - Intronic
992584536 5:78222400-78222422 TCCAGATGGTTCTCTTCTCCTGG - Intronic
992739053 5:79754826-79754848 TCCATATTCTCCCCTTCTCCTGG + Intronic
993470223 5:88298602-88298624 TCCAGATTGCTCCCTTTTCCTGG - Intergenic
996603884 5:125297945-125297967 CCCAGATTATGCCCTTGTCCTGG - Intergenic
997009578 5:129860695-129860717 CCCAAATTGTTGCCTTCTCCAGG - Intergenic
997638689 5:135434527-135434549 CCCAGCTTGTGCCCTTCTGCAGG - Intergenic
997837433 5:137207120-137207142 TCCAGAATGTCCTCTTGCCCAGG + Intronic
1002321384 5:178378066-178378088 ACCTGGTGGTCCCCTTCTCCTGG - Intronic
1003442874 6:6159611-6159633 TGCAGATTGTGCCCATCTGCAGG - Intronic
1004134924 6:12957209-12957231 TGCAGTTTGTCTCCTTCTGCAGG - Intronic
1004908738 6:20261196-20261218 TCCAGGTTGTCCACTCCTACTGG + Intergenic
1006639779 6:35484061-35484083 TCCCGAGTGTCACCTCCTCCAGG + Intronic
1006891358 6:37432190-37432212 TCCAGCATGACCCCTTCTTCAGG - Intergenic
1008955680 6:57213319-57213341 TCCAGATTGTACCCTAGACCAGG - Intronic
1010989653 6:82466123-82466145 TTTTGATTGTCACCTTCTCCAGG - Intergenic
1013599728 6:111692637-111692659 TCGAGTTTTTCCCCTTTTCCTGG - Intronic
1017312196 6:152987010-152987032 TACAGATTATTCCCTTATCCTGG - Intergenic
1018079170 6:160243981-160244003 TCCAATTTCTTCCCTTCTCCTGG - Intronic
1018738079 6:166704654-166704676 TCCAGATTGCCTGGTTCTCCTGG + Intronic
1019590673 7:1829184-1829206 TCCTGATGGTCCCCACCTCCAGG + Intronic
1023278101 7:38542120-38542142 CCAAGATGGTCCTCTTCTCCAGG + Intronic
1024225100 7:47320619-47320641 TCCTGATCGCCCCCTTCTACAGG + Intronic
1024229356 7:47352621-47352643 TCCATCCTGGCCCCTTCTCCAGG + Intronic
1024300250 7:47882010-47882032 ACCAGGTTATCCCCATCTCCAGG + Exonic
1026487178 7:70831337-70831359 TCCACAGGGTCCCCTGCTCCAGG - Intergenic
1026577819 7:71588701-71588723 TCCAGATTGGCAGCTTCTCTGGG - Intronic
1026828727 7:73599245-73599267 CCCAGAAACTCCCCTTCTCCAGG + Intronic
1027131152 7:75592262-75592284 CCCACACTGCCCCCTTCTCCTGG - Intronic
1027779986 7:82508242-82508264 TCCTGCTTGTTCCCTGCTCCAGG + Intergenic
1028326967 7:89539906-89539928 GCCAGAGTGTACCCTTCTTCAGG - Intergenic
1029687372 7:102158022-102158044 TCCAGTTGGCCACCTTCTCCTGG + Intronic
1030542424 7:110847580-110847602 TCCAGGTTTTTTCCTTCTCCAGG - Intronic
1031550261 7:123102191-123102213 TACAGATTTTTCTCTTCTCCTGG - Intergenic
1031994107 7:128217228-128217250 TCCAGCTTGTCCCATTCTCCTGG - Intergenic
1033188414 7:139251843-139251865 TGCAGATAGTCCCCCTCTCCAGG - Intronic
1033630522 7:143153252-143153274 CCCTGAGTGTCCCCTTCACCTGG + Intergenic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1035572565 8:682509-682531 TCCAGAATGTCCACATCTCCAGG + Intronic
1037343985 8:17878478-17878500 TCCAGCATCTCCCCTTCTTCAGG - Intronic
1037648463 8:20815346-20815368 GCCCAATGGTCCCCTTCTCCTGG + Intergenic
1037972351 8:23181900-23181922 TTTTGATTGTCACCTTCTCCTGG + Intergenic
1040650189 8:49439437-49439459 TTTTGATTGTCACCTTCTCCGGG + Intergenic
1041538535 8:58956029-58956051 TCAAGAATGTCCTCTTCTGCCGG - Intronic
1041940297 8:63380447-63380469 ATCAGATTCTCCCCTTATCCAGG + Intergenic
1042121175 8:65490065-65490087 TCCTGCTCCTCCCCTTCTCCTGG + Intergenic
1042203812 8:66307903-66307925 TTCTGATTTTCCTCTTCTCCTGG - Intergenic
1043322112 8:79000412-79000434 TCCATTTTGTCCCCTTTTCATGG + Intergenic
1047670858 8:127144937-127144959 TTTTGATTGTCACCTTCTCCTGG + Intergenic
1047772435 8:128040113-128040135 TCCAGAGTGTCCACTTGGCCAGG + Intergenic
1048459743 8:134611570-134611592 TCCAGCTTCTCCCCCTCCCCAGG - Intronic
1049346108 8:142139569-142139591 TCCAAATTGCCTCCTTTTCCAGG - Intergenic
1052407657 9:28082946-28082968 TCATTATTGTCCCCTCCTCCAGG + Intronic
1053081039 9:35176973-35176995 TCCATATTTTCCCTTTCTCTTGG - Intronic
1055436472 9:76296840-76296862 TCCAGAATTTGCCCTCCTCCTGG - Exonic
1056276189 9:84996810-84996832 TACAGCTTGTCCCCTACTTCAGG + Intronic
1056279432 9:85026643-85026665 TGCAGAATGTCCACATCTCCAGG - Exonic
1056553803 9:87672924-87672946 ACCCGATTGTCTCCTCCTCCAGG - Intronic
1057238644 9:93388857-93388879 TCCTCATTTTCCCCTTCCCCTGG + Intergenic
1057245953 9:93453666-93453688 TCCCGATTGGCCCCTGCGCCTGG + Intronic
1058161459 9:101574541-101574563 TCCAGATTGTCCCCTTCTCCTGG - Intronic
1186312893 X:8339552-8339574 TCCAGATGGTCTCCAGCTCCTGG - Intergenic
1186336047 X:8589827-8589849 CCCAGATATGCCCCTTCTCCTGG + Intronic
1187713506 X:22077832-22077854 TCCAGAATATTCCCTTCTCCCGG + Intronic
1188765593 X:34087902-34087924 TCCAGAATTTCCCGTGCTCCTGG - Intergenic
1188789263 X:34388112-34388134 TCCAGATCGGCCCCTGCTACAGG - Intergenic
1189234710 X:39478110-39478132 GCCAGAGTGACCCTTTCTCCAGG - Intergenic
1190306905 X:49088921-49088943 TTCAGATTGTCTCCTTCCCAGGG - Intronic
1190331299 X:49237064-49237086 TCAAGCTGGTCCCCTTCTTCAGG + Exonic
1191251902 X:58263802-58263824 CCCTGATTGTCCCCTTCTTCCGG - Intergenic
1193082245 X:77417361-77417383 TCTTGATTGTTCTCTTCTCCTGG - Intergenic
1193413649 X:81196096-81196118 TGCAGATACTCCCCTTCTGCTGG + Intronic
1193573334 X:83172270-83172292 TCCAGCTTGTCCCTGGCTCCTGG - Intergenic
1195152102 X:102082470-102082492 TCCAGCTTGTCTTCTGCTCCTGG + Intergenic
1195288610 X:103409885-103409907 TCCAGCTTGTCCTCTGCTCCTGG - Intergenic
1196478075 X:116112219-116112241 TCCTGATTCACCCCTTCCCCTGG + Intergenic
1197083120 X:122441657-122441679 TCCAGATTGTCCCCAGCACCAGG - Intergenic
1197123196 X:122914870-122914892 TCCAGATTGCCCCCGGCACCAGG - Intergenic
1197719588 X:129736051-129736073 TCCAGGTTCTACCCTTCCCCGGG + Intergenic
1200057329 X:153468511-153468533 TCCAGAGTGTCCCATTCCCAGGG - Intronic
1200835649 Y:7728792-7728814 TCCATATTTCCCCTTTCTCCAGG - Intergenic