ID: 1058162955

View in Genome Browser
Species Human (GRCh38)
Location 9:101590179-101590201
Sequence ATGAAAAATTCTAACACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 387}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058162955_1058162957 29 Left 1058162955 9:101590179-101590201 CCTTCAGTGTTAGAATTTTTCAT 0: 1
1: 0
2: 6
3: 33
4: 387
Right 1058162957 9:101590231-101590253 GATTTATAGTTCACAGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058162955 Original CRISPR ATGAAAAATTCTAACACTGA AGG (reversed) Intronic
900905103 1:5551588-5551610 ATGAAAAAAAGTCACACTGACGG - Intergenic
907541248 1:55216528-55216550 ATAAAATATTCTAACGCTAATGG + Intergenic
908038831 1:60085427-60085449 ATGAAAAATTATTAATCTGATGG + Intergenic
909869101 1:80716899-80716921 ATGAAAAAGTATATGACTGAAGG - Intergenic
910555477 1:88527362-88527384 TTGAAAAATTCTAAAATTAAAGG + Intergenic
911064422 1:93775153-93775175 TTGAAAGATTCTAGGACTGAGGG - Intronic
911659045 1:100479201-100479223 TTGAAAAAGTCTAACACTAATGG + Intronic
912795506 1:112690782-112690804 ATGAAATGTTCTAAAACCGATGG - Intronic
915184784 1:154096292-154096314 CTGAAAATTTCTATCCCTGATGG + Intronic
916209975 1:162352382-162352404 AGGAGAAATTCCAACACTTAAGG - Intronic
916505810 1:165427379-165427401 ATGACAGATTCCAACATTGATGG - Intronic
917013496 1:170502616-170502638 ATTTAAAAATCTAACATTGATGG - Intergenic
917212904 1:172647884-172647906 AGGCAAAATTCTAACTCAGAGGG - Intergenic
917656157 1:177127736-177127758 AAGTAAAATTGTAACACTGTGGG - Intronic
918708690 1:187700896-187700918 TTGTAAAACACTAACACTGAAGG + Intergenic
918884056 1:190167443-190167465 ATGAAAAATTCAAAGACTGTGGG + Intronic
919259708 1:195176328-195176350 ATGAAAAAGTTAAGCACTGAAGG + Intergenic
919300594 1:195758547-195758569 ATGAAATATTCTAACAAAGGTGG + Intergenic
919543037 1:198875016-198875038 ATGAAACATTGTAACACTCTAGG - Intergenic
919740177 1:200976673-200976695 ATGAAAAATTATAAGACTTCTGG - Intronic
919882435 1:201909348-201909370 CAGAGAAATTCTAACACTGGAGG + Intronic
921522179 1:216169210-216169232 TTGAAAAATTTTAACAGTGATGG + Intronic
921735174 1:218619359-218619381 ATGAAGAATTATGACACTGTTGG - Intergenic
923456770 1:234171438-234171460 ATGTAAATTTCTTACACAGAGGG + Intronic
924683748 1:246265951-246265973 ATGAATGTTTTTAACACTGAAGG + Intronic
1063211052 10:3881663-3881685 AAGAAAAATTATAACAGTAAGGG - Intergenic
1063246924 10:4230398-4230420 ATACAAAATTATAAAACTGAAGG - Intergenic
1063570329 10:7209711-7209733 ATGCAAAATACTAACACAGTGGG + Intronic
1063871172 10:10419502-10419524 ATCAATAATTCTAACACTTTAGG + Intergenic
1064408523 10:15085512-15085534 ATAAAAAATTCTCACACTCAAGG + Intronic
1064828784 10:19438014-19438036 ATAAAAAAATCTAAAACTCACGG - Intronic
1064948697 10:20821511-20821533 ATGAAAAAGTATAACATTGTAGG - Intronic
1065193958 10:23243375-23243397 ATGAAAAATTTTATCACTGATGG - Intergenic
1065511445 10:26482427-26482449 TTGAAAAAATACAACACTGAAGG + Intronic
1065579033 10:27153294-27153316 ATTAAAAATTCTTAAAATGAGGG + Intronic
1066130773 10:32391223-32391245 ATGTAAAATTCTCACAGAGAAGG - Intergenic
1066210536 10:33233039-33233061 ATATGAAATTCTAACACTGGTGG + Intronic
1066672937 10:37858937-37858959 ATGTAAAATACTAACACTAGTGG - Intergenic
1067429026 10:46230518-46230540 ATGAAACATTCATACACTGATGG + Intergenic
1067932717 10:50579377-50579399 AAGAAAATTTCTAAAAATGAAGG + Intronic
1070354679 10:75628347-75628369 ATGAAAAATGCTAAGTTTGAGGG + Intronic
1070491760 10:76983094-76983116 ATGTAAAAGTCAAACCCTGACGG - Intronic
1070759811 10:79017033-79017055 ATGAAAAATACCTACTCTGAGGG - Intergenic
1070846383 10:79525397-79525419 ATGGAAATTTACAACACTGAAGG - Intergenic
1070927408 10:80234881-80234903 ATGGAAATTTACAACACTGAAGG + Intergenic
1070940026 10:80336446-80336468 ATTAGCAATTCTAACATTGAAGG - Intronic
1071507867 10:86243566-86243588 ATGAAAACAGCTAACACAGAGGG + Intronic
1073524664 10:104168946-104168968 AAGACAAACTCTACCACTGAAGG - Intronic
1073771166 10:106737350-106737372 CAGAAAAATGCAAACACTGATGG - Intronic
1075421831 10:122307389-122307411 ATGAAAAATTATATCACTGATGG - Intronic
1075693384 10:124416559-124416581 AGCTAGAATTCTAACACTGAAGG + Intronic
1075946698 10:126439635-126439657 ATTAGAAATTCTGAAACTGAAGG + Intronic
1076532865 10:131156480-131156502 TTGAAAAATGCTTACACTAAGGG + Intronic
1076672121 10:132128272-132128294 AGGAACAATTCTAAGAGTGATGG - Intronic
1077583544 11:3433450-3433472 ATTAAAATTTCTAAAACTGATGG - Intergenic
1077961354 11:7079567-7079589 TTCAAAAATTCTAACACCCATGG - Intergenic
1078962132 11:16288608-16288630 ATTAAATATTCTAACATTTATGG + Intronic
1079728903 11:23915623-23915645 ATGAAAATTTTAAACACTGACGG - Intergenic
1080740200 11:35056829-35056851 ATGAAGAATCCTTACAGTGAAGG + Intergenic
1080775158 11:35379237-35379259 AAGAAAAATTGTGACACAGAGGG + Intronic
1080992581 11:37556829-37556851 ATGAAAGAATCCAACACTGGGGG + Intergenic
1081679683 11:44993128-44993150 TTGAAAAATTCAAACTCTGCTGG + Intergenic
1081890607 11:46539015-46539037 AATAAAACTTCTTACACTGATGG - Intronic
1082577599 11:54828381-54828403 AAGGAAAGTTTTAACACTGAGGG - Intergenic
1084240464 11:67816261-67816283 ATTAAAATTTCTAAAACTGATGG - Intergenic
1084831970 11:71776583-71776605 ATTAAAATTTCTAAAACTGATGG + Intergenic
1084869749 11:72090304-72090326 ATGGGAATTTCTAACTCTGATGG + Intronic
1086023107 11:82256147-82256169 ATGAAAAAATATAAGACTGGTGG - Intergenic
1086860796 11:91922863-91922885 AGGAAAAAGTCAGACACTGATGG - Intergenic
1087165154 11:94995867-94995889 TGGAAAAATCCTAACCCTGATGG + Intronic
1087236210 11:95721441-95721463 AGGAACAATTGTCACACTGATGG + Intergenic
1088939862 11:114442344-114442366 AAAAAAAATACTAACAATGATGG - Intronic
1090312308 11:125752213-125752235 AGGATAAATTCTAACCATGATGG + Intergenic
1091147705 11:133294342-133294364 AGGAAGAATTCTATCACTGCTGG + Intronic
1092410692 12:8250818-8250840 ATTAAAATTTCTAAAATTGATGG - Intergenic
1092693811 12:11145536-11145558 TTGAGAAATTCTAATATTGAGGG - Intronic
1093549791 12:20394237-20394259 ATGAAACAGTCTACCATTGAAGG - Intronic
1094324180 12:29218866-29218888 AAATAAAATTCTAACACGGAAGG - Intronic
1094561551 12:31558637-31558659 ATGAAAAATACTCATACTGATGG + Intronic
1094661647 12:32474934-32474956 ATGAAAAGGTCTAAAATTGATGG + Intronic
1094803065 12:34060618-34060640 AAGAAAAAATCTCACAATGATGG + Intergenic
1095137216 12:38619540-38619562 AAGAAAATTTCTATCACTGGGGG + Intergenic
1095359676 12:41321201-41321223 ATGGAAAACTCAAACACTAAAGG - Intronic
1095376596 12:41536434-41536456 ATGAAAAAGTGTAGCACAGAGGG + Intronic
1095858119 12:46884425-46884447 TTGCAAAATTCTAACAAAGATGG - Intergenic
1096410093 12:51370986-51371008 ATGAAAAATCCAAACACTGTCGG + Intronic
1097608949 12:61793404-61793426 AAGAAAAATTTTAAAAGTGATGG + Intronic
1097772317 12:63602303-63602325 AAGAAAAATTCAAATAATGAAGG + Intronic
1098074070 12:66707802-66707824 ATGTAACATTTTAAAACTGATGG - Intronic
1098664500 12:73144529-73144551 AATAAATATTCTAACAATGAAGG + Intergenic
1099110126 12:78548285-78548307 ATGAAAAATTTTAAAAATTAAGG + Intergenic
1099237747 12:80102358-80102380 ATGAAAAGGTCTACCATTGAGGG - Intergenic
1099420759 12:82457309-82457331 AATAAATATTCTACCACTGAGGG + Intronic
1101547732 12:105732391-105732413 TTTTAAAATTCTATCACTGAAGG + Intergenic
1102368089 12:112356776-112356798 ATGATATATTCAAACACTTATGG + Intronic
1102762498 12:115400484-115400506 ATGTAAGATATTAACACTGAGGG - Intergenic
1102837608 12:116080050-116080072 ATGAAATATACTAGCACTAATGG - Intronic
1103148848 12:118619364-118619386 AGGAAAAATGCTAAGGCTGAGGG - Intergenic
1105443136 13:20431742-20431764 TTGAAAAATTATAACACTGAGGG + Intronic
1105932064 13:25061906-25061928 AGGGAAAAATCTAACACTTAAGG - Intergenic
1107655229 13:42586145-42586167 ATGAAAAATTTTTTCCCTGATGG + Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108473949 13:50795023-50795045 ATTAAATATTCTATTACTGATGG + Intronic
1109154574 13:58890444-58890466 ATGAAAATTTCAAAAAGTGATGG - Intergenic
1109246318 13:59958126-59958148 TGGAAAAATTTTATCACTGAGGG - Intronic
1109397604 13:61780415-61780437 ATGAAAAATTGTAGCAATCATGG - Intergenic
1109568853 13:64158708-64158730 ATGAATAATTCTGCCTCTGAAGG + Intergenic
1110427165 13:75381373-75381395 ATTAGAAATCCTAAAACTGATGG - Intronic
1110461962 13:75755055-75755077 ATGAGGCATTCCAACACTGAAGG + Intronic
1111849964 13:93560543-93560565 AAGCAAAATTCTAACAAGGAAGG - Intronic
1112076098 13:95915171-95915193 ATTAACAATTCAAATACTGAGGG - Intronic
1112283312 13:98081734-98081756 ATGAAAAATTCTACCTCATAGGG - Intergenic
1113061310 13:106325198-106325220 ATGAAAAACTGTAACATTAATGG - Intergenic
1113636302 13:111921237-111921259 ATGAAATATTCTCTCAGTGAAGG - Intergenic
1114331346 14:21640104-21640126 AAGAAAAATTCTAACCTCGAGGG + Intergenic
1115517122 14:34196908-34196930 ATGAAAATTTTTAAAATTGAAGG - Intronic
1115746317 14:36441343-36441365 CAGAAAAATTCTTGCACTGAGGG - Intergenic
1115926598 14:38442519-38442541 ATGCCAAAATCTAACAATGATGG - Intergenic
1116523897 14:45881248-45881270 ATGAATAATTCTAGCATTGATGG + Intergenic
1116587628 14:46728993-46729015 ATGAAAAAAACTAACGTTGAAGG - Intergenic
1116778734 14:49212332-49212354 ATGAAAGATTATAACCCTCAGGG - Intergenic
1117291289 14:54336192-54336214 TTGCAAAATGCTACCACTGAGGG + Intergenic
1118164645 14:63324388-63324410 ATGAAGAATTTTTGCACTGATGG + Intergenic
1119946416 14:78699766-78699788 ATCAAATATTCTAAAACAGAAGG + Intronic
1120258222 14:82147215-82147237 ATAAAAAATTCTCAGACTTATGG + Intergenic
1120649111 14:87109766-87109788 ATGAACAATTCCTACACTGCTGG - Intergenic
1120767969 14:88348125-88348147 ATCAAAGACTTTAACACTGAAGG - Intergenic
1120837088 14:89050007-89050029 AGGAAAATTTCTAGCATTGAAGG + Intergenic
1121825408 14:97006473-97006495 ATGAAAGATTGTTACAGTGAAGG - Intergenic
1122997047 14:105270818-105270840 ATGAAAGATCCTGATACTGAGGG + Intronic
1126288676 15:47046132-47046154 ATGAAAAATTCTACAACTACTGG - Intergenic
1126955754 15:53931933-53931955 ATTAAAAACACTAACACTGATGG - Intergenic
1127209351 15:56757214-56757236 ATGAAATATTCTAAAACTGATGG + Intronic
1127421511 15:58810923-58810945 ATAAAAAATCTGAACACTGAAGG - Intronic
1127672612 15:61210350-61210372 AAGAAAAATTCCAAAACTGAAGG + Intronic
1130039817 15:80397129-80397151 ATGAAATATTCTAATACTCATGG - Intronic
1130215747 15:81967459-81967481 AGGAAAAATACAAACACAGAAGG + Intergenic
1130645921 15:85727008-85727030 ATACAATATTCTAACTCTGAAGG - Intronic
1130760952 15:86819143-86819165 GGGCAAAAATCTAACACTGAAGG + Intronic
1131218031 15:90556393-90556415 AGCAAAACTTCTGACACTGATGG + Intronic
1131934279 15:97485348-97485370 ATGAAATATTCTGAAACTCAAGG - Intergenic
1132334369 15:101036565-101036587 ATTAAAAATTCTGATACTAAAGG - Intronic
1133208966 16:4252285-4252307 ATGCAAGATGTTAACACTGAGGG + Intergenic
1133351911 16:5106998-5107020 ATTAAAATTTCTAAAACTGATGG - Intergenic
1133526669 16:6612248-6612270 ATGCAAAATTTTAACATTTAGGG - Intronic
1135203091 16:20456583-20456605 TTAAAAATTTCTCACACTGAAGG + Intronic
1135204022 16:20467098-20467120 TGGAAAAATTATGACACTGAGGG - Intronic
1135214978 16:20557825-20557847 TGGAAAAATTATGACACTGAGGG + Intronic
1135216008 16:20571278-20571300 TTAAAAATTTCTCACACTGAAGG - Intronic
1137658524 16:50182839-50182861 AGGAAAACTTTTAACACTCAAGG + Intronic
1138133230 16:54499928-54499950 CTGAAAATTTCTAATAATGAGGG + Intergenic
1138661601 16:58522017-58522039 ATTAAGTATTCTAACACTGCAGG + Intronic
1138959527 16:62011956-62011978 ATGAAATATTCAAAGACTTAGGG + Intronic
1140068271 16:71627563-71627585 ACGTAAAATTCTCCCACTGAAGG + Intronic
1140323372 16:73975802-73975824 GTGAAAAATTCAAAGACTCATGG + Intergenic
1141032166 16:80598575-80598597 CTGAAAAATTCTTACCCTGGAGG + Exonic
1141812821 16:86387334-86387356 ATAAAAAATACTAACACATATGG + Intergenic
1145052131 17:19670882-19670904 ATGAGAAACCCTAACTCTGAGGG - Intronic
1147737564 17:42650071-42650093 AGGAAAAATTAAAACAATGATGG - Intergenic
1149171166 17:53813094-53813116 ATGCAAAATTATAACATTAATGG + Intergenic
1151046137 17:70921691-70921713 ATTAAAAATTCCAACTCTGGTGG + Intergenic
1153325987 18:3820700-3820722 ATGAAAAAATCTGACAATTATGG + Intronic
1153325996 18:3820863-3820885 ATGAAAAAATCTGACAATTATGG + Intronic
1155122379 18:22835190-22835212 AAGAAAGTTTCTCACACTGAAGG + Intronic
1155136209 18:22995399-22995421 ATTAAAAACTATAACATTGATGG - Intronic
1155810869 18:30233420-30233442 ATGAAAAATTAAAACAATGCAGG + Intergenic
1157021685 18:43790628-43790650 TTAAAAAATAGTAACACTGATGG + Intergenic
1158490341 18:57904333-57904355 AAGAAATATTTTAACACTTAGGG - Intergenic
1159050256 18:63415183-63415205 ATGAAAAATGCTAACAGACATGG - Intronic
1159519735 18:69504041-69504063 ATGGAAAATTATAATACTGTAGG + Intronic
1159871587 18:73764351-73764373 ATGATATATTTTAACAGTGATGG + Intergenic
1160224294 18:77000219-77000241 TGGAAAAATTCTACCACCGAAGG + Intronic
1163485835 19:17585064-17585086 ACAAAAAACCCTAACACTGATGG + Intergenic
1164450028 19:28352517-28352539 ATGATATATTCAAACACTGAAGG + Intergenic
1164498948 19:28796087-28796109 TTGAAAAAATCTAACACTCCTGG - Intergenic
1164679785 19:30126274-30126296 ATGTAAAATCCTAACAATGTGGG + Intergenic
1168361516 19:55744777-55744799 ATGAAAATATCGAAAACTGAAGG - Intergenic
926308023 2:11653974-11653996 ATGAAGGATTCTTACAGTGATGG - Intergenic
926371895 2:12187098-12187120 ATGTAATATTCTAACACACATGG + Intergenic
926960887 2:18357367-18357389 ATGGAGACTTCTAACCCTGATGG + Intronic
927003481 2:18823879-18823901 ATGAAAGAAACTAACACTCAGGG - Intergenic
929052297 2:37848172-37848194 ATGATAAATTCTATCAGGGAGGG + Intergenic
930609908 2:53530611-53530633 AACAAAATTTCTAGCACTGAGGG - Intergenic
931216442 2:60249289-60249311 ATGAAAGATAGTAACACTAAAGG + Intergenic
931908261 2:66866622-66866644 ATGAAAGCTTATAATACTGAAGG - Intergenic
932964963 2:76462417-76462439 CTGAAAATTTCTAACAATCATGG + Intergenic
933502481 2:83132206-83132228 ATAAAAAATTGTAACAGTAAAGG - Intergenic
933874030 2:86600551-86600573 ATCATAAATTCTAACACATAGGG + Intronic
934962958 2:98693917-98693939 AAAAAAAATTAAAACACTGAAGG + Intronic
935899754 2:107778828-107778850 ATTAAAAATCCTCACACTCAAGG + Intergenic
936096611 2:109535104-109535126 CTGGAAAATTCTACCACTTAGGG + Intergenic
936585087 2:113749700-113749722 ATGAAAAATTCTGGAGCTGATGG + Intronic
938809122 2:134835548-134835570 ATGTAAAATTTTAACAATGAAGG - Intergenic
940267366 2:151853044-151853066 ATAAAAGATTATGACACTGAAGG - Intronic
940818342 2:158322099-158322121 ATGAAAAATTCTAAGACTTTTGG - Intronic
941068987 2:160934943-160934965 ATGAAACAGTCTATCACTGTAGG + Intergenic
941247707 2:163121330-163121352 ATAAAAAATTAAAACCCTGAAGG - Intergenic
941459735 2:165754997-165755019 ATGTAAAATTTTTACACTGAAGG + Exonic
941584724 2:167343385-167343407 TTGACAAATTGTAACACTCAGGG + Intergenic
941835898 2:170020125-170020147 TAGTAAAATTCTGACACTGATGG + Intronic
942703731 2:178744390-178744412 ATAAAAAATTCTGAAAATGAAGG - Intronic
943535730 2:189147667-189147689 TGGAAAAATTCAAATACTGAGGG + Intronic
945350140 2:208767934-208767956 ATGAAAAATTATGACATTAAAGG - Intronic
945448976 2:209971947-209971969 ATGAAAAATTAGAATACTTATGG - Intronic
945460017 2:210095505-210095527 AAGAATAATAATAACACTGAAGG - Intronic
945595640 2:211787524-211787546 ATGATAATTTCAAACACTTATGG - Intronic
947510718 2:230751910-230751932 ATGCAAAATTCAAACATTAAAGG - Intronic
947553899 2:231071683-231071705 AAGAAAAATTCTAACTTTGTTGG + Intronic
948023171 2:234754040-234754062 ATGTAAAATTCTAATACTTGTGG - Intergenic
948202445 2:236139274-236139296 ATAAAAAATTCTACCCCTAATGG - Intergenic
1170792934 20:19522549-19522571 ATCAAAAACCTTAACACTGACGG - Intronic
1173533827 20:43793307-43793329 AGGAAAATTTCTAGAACTGAAGG + Intergenic
1173539638 20:43841753-43841775 TTGAAAAATTCAAACTCAGAAGG + Intergenic
1174440449 20:50547656-50547678 CTGAAAAATTTTAACACGGCCGG - Intronic
1175027451 20:55917586-55917608 ATGAAATATTATAACATTGGAGG - Intergenic
1175462896 20:59166622-59166644 ATGACAAATTATAAAACTGGAGG - Intergenic
1175870528 20:62207484-62207506 CTGCAAAATTCTAACACCAACGG - Intergenic
1177347617 21:19893661-19893683 CAGAAAAATTCTACCTCTGAAGG + Intergenic
1179519870 21:41935564-41935586 CAGAAAAGTTCTGACACTGAGGG + Intronic
1179520566 21:41941690-41941712 ATGAAATGTTCTAGAACTGATGG - Intronic
1181665327 22:24391584-24391606 CTGAAAAATGCTCACAGTGAGGG - Intronic
1183029521 22:35093094-35093116 AGCAAAAATTCAAACACTGAGGG - Intergenic
1183133804 22:35867035-35867057 ATGAAATTATCTAAGACTGAAGG + Intronic
1183991957 22:41603121-41603143 ATGGCAGATTCTAACACAGAAGG - Intronic
1184314093 22:43669772-43669794 ATAAAAAATTATATGACTGAAGG + Intronic
949516272 3:4810040-4810062 ATGAAAAATTCTAAATTGGAAGG + Intronic
951600688 3:24371537-24371559 ATGAGTAATTCTGACACTGCCGG - Intronic
951914598 3:27786955-27786977 ATGAAAAAGTCTACCAGTAAAGG - Intergenic
952056577 3:29453876-29453898 GTGAAAAGTGCTAAGACTGAGGG + Intronic
952915939 3:38241957-38241979 ATGGTAAATTCTGACAATGATGG - Intronic
954343167 3:49972283-49972305 GTGCAAAATATTAACACTGAGGG - Intronic
956124485 3:65998320-65998342 ATGAAGTATTCTCACACTCAGGG - Intronic
956319008 3:67974462-67974484 TTGCAAAATTGTACCACTGAAGG + Intergenic
957055917 3:75442927-75442949 ATTAAAATTTCTAAAATTGATGG - Intergenic
957630350 3:82710067-82710089 ATAAAAAATTCTATTACTAAGGG - Intergenic
958144839 3:89611774-89611796 ATGAAAAATCCTTAAACTTAGGG - Intergenic
958714691 3:97765024-97765046 AAGAGGAATTCTAAAACTGACGG - Intronic
959423550 3:106157095-106157117 ATGCAAGATCTTAACACTGAGGG - Intergenic
960284668 3:115814376-115814398 ATAAAACATTCTGAAACTGAGGG + Intronic
960834105 3:121886449-121886471 ATAAAAATTCCTAAGACTGAGGG + Exonic
961045118 3:123702824-123702846 ATTAAAAAATATAATACTGAAGG + Intronic
961254291 3:125534119-125534141 ATGAATAATTCTAGCACTTTGGG + Intronic
961298459 3:125905676-125905698 ATTAAAATCTCTAAAACTGATGG + Intergenic
962674198 3:137741821-137741843 ATGCAAAATTCTCACATAGATGG - Intergenic
965183030 3:165428616-165428638 ATGAAATATTGCAACACTTAGGG + Intergenic
965441994 3:168725776-168725798 GTGAAAAATTCTGGCACTGTGGG + Intergenic
965798919 3:172471160-172471182 GTGAAAAATTCTTACAATGAAGG + Intergenic
966650382 3:182294422-182294444 ATGAAGATTCCTAACATTGAAGG - Intergenic
967328218 3:188263749-188263771 AAGAAAAATGCTATCAGTGATGG - Intronic
967463106 3:189770221-189770243 ATAAAAAATTCTAACAAGGATGG - Intronic
967513491 3:190340123-190340145 ATAAAAACTTCTAACACTTTAGG + Intronic
967526225 3:190496335-190496357 ATGAAAATTTCTTAAACAGATGG + Intergenic
969755269 4:9145397-9145419 ATTAAAATTTCTAAAATTGATGG + Intergenic
969815169 4:9681596-9681618 ATTAAAATTTCTAAAATTGATGG + Intergenic
970537680 4:17045805-17045827 AGGAAAAGTTCTGACCCTGAGGG + Intergenic
971168260 4:24206526-24206548 ATAAAAAATACTAACATTGGAGG + Intergenic
971771051 4:30897655-30897677 ATGAATAATTCTATTATTGATGG + Intronic
972040251 4:34585570-34585592 AAATATAATTCTAACACTGAGGG + Intergenic
974154175 4:58049177-58049199 ATGAAAAATTTTAAGACTTAGGG - Intergenic
974459611 4:62170667-62170689 ATCAAAGATTTTAAGACTGAAGG + Intergenic
975215352 4:71747256-71747278 ATTAAAAATCCTAATGCTGAGGG + Intronic
976035854 4:80820165-80820187 ATGAAAAATTATAGCACTATAGG - Intronic
976212453 4:82685133-82685155 ATAAAAAATTGGAATACTGAAGG + Intronic
976711792 4:88080168-88080190 ATGAAAAAATCAAACCCTTATGG - Intergenic
976934462 4:90612393-90612415 ATGAGAAAGGCTAAAACTGATGG - Intronic
977448683 4:97165589-97165611 ATGTAAAATTCTAAAACTTATGG - Intergenic
977730596 4:100346588-100346610 ATGAAAAAATCTAAAAGTGTAGG + Intergenic
978135871 4:105258910-105258932 ATGAATTATTCTACCATTGATGG - Intronic
978221728 4:106284718-106284740 CTGAATAATTCTAACACAAAAGG + Intronic
978333149 4:107637168-107637190 TAGAACAATTCTAACTCTGAAGG - Intronic
979233869 4:118377078-118377100 AAAAAAAATGCTAAAACTGATGG + Intergenic
980097155 4:128503228-128503250 ATGTAAAATGTTAACACTGGGGG - Intergenic
980749709 4:137072291-137072313 ATGAAAACCTCTTACACTGTTGG - Intergenic
980924896 4:139126426-139126448 ATAAAATTTTCTAAGACTGAAGG + Intronic
980984312 4:139681007-139681029 AAAAAAAATTCTAAAACAGAAGG - Intronic
981249090 4:142577644-142577666 ATGAGAAAAGCTAGCACTGAAGG - Intronic
982245482 4:153345864-153345886 GAGAAAAATTGTAACACAGAAGG - Intronic
983039594 4:162909749-162909771 AGGGAAGATTCTAAAACTGAAGG + Intergenic
983877230 4:172891920-172891942 ATGAAAATTTCAAATACTGTTGG - Intronic
984010308 4:174363124-174363146 ATGAAAAATGCCGACATTGAGGG + Intergenic
984175991 4:176417612-176417634 AGGGAAATTTCGAACACTGAAGG - Intergenic
984363953 4:178774363-178774385 ACGAAAAATTTTAACACAGTTGG + Intergenic
984580756 4:181507285-181507307 AAGGAAAATTCTCACCCTGAAGG - Intergenic
985858563 5:2450523-2450545 ATTAAAACTTCTAAAACAGATGG - Intergenic
986367662 5:7049842-7049864 AAAAAAAATTCAAACAATGAAGG + Intergenic
986465010 5:8012224-8012246 ATGTTAAATTCTAACCCTCATGG + Intergenic
986620491 5:9667783-9667805 ATAACAAATTCAAATACTGAAGG + Intronic
986791480 5:11165368-11165390 AGGAAAAACTATAAAACTGATGG + Intronic
989547324 5:42689646-42689668 ATGAAAAAGGCCAGCACTGAAGG + Intronic
989846469 5:46150186-46150208 AAGAAAAAGTTTAACACTGTGGG - Intergenic
990670857 5:58128728-58128750 ATGATAATTTATAATACTGATGG - Intergenic
990859371 5:60309595-60309617 AAGAAATATTATAACCCTGAGGG - Intronic
991361995 5:65830495-65830517 ATGGAAATTATTAACACTGATGG - Intronic
993174341 5:84463467-84463489 ATGTAAAATTCTACCACCCAAGG - Intergenic
993430613 5:87828198-87828220 ATAAAACAATCTAACACAGAAGG + Intergenic
993672746 5:90781518-90781540 ATGAAAAATGATAACGCAGAAGG + Exonic
993907682 5:93641689-93641711 CTTAAAAATTCTAACAATGGGGG + Intronic
994017250 5:94981779-94981801 CTGAAGAATTCTAACATTGCTGG + Intronic
994602955 5:101930448-101930470 ATGGAAAATTATAATTCTGAGGG + Intergenic
994860827 5:105190766-105190788 ATGAAAAATTATGACACTAAAGG + Intergenic
995315541 5:110767788-110767810 CTGGAAAATTATAACACTGTGGG - Intergenic
996546812 5:124688148-124688170 ATGAAGAATTCAAACACTCAAGG - Intronic
997429604 5:133828365-133828387 GTGAAAAATCCTGTCACTGAGGG - Intergenic
998050475 5:139028628-139028650 ATGTAAAATGTTAACATTGAGGG - Intronic
999836966 5:155384171-155384193 ATACAAGATGCTAACACTGAGGG - Intergenic
1000650613 5:163813899-163813921 AGGAAAAATACTAAACCTGATGG - Intergenic
1000785647 5:165540311-165540333 ATGAAAAATTCCACAACTAAAGG - Intergenic
1000794548 5:165648702-165648724 AGGAGAAATTCCACCACTGAGGG - Intergenic
1000883968 5:166729649-166729671 ATTAAAAATGCTAACAGTTATGG + Intergenic
1000918811 5:167114557-167114579 ATGAAAAATTCTAACACATATGG - Intergenic
1000968645 5:167689688-167689710 ATGCTAAATTCTATCAGTGAAGG + Intronic
1002386765 5:178873906-178873928 ATGAAAACTACAAACACTGATGG - Intronic
1003794311 6:9582750-9582772 ATGAAAATTTCAAACTCTAAAGG + Intergenic
1004406277 6:15336603-15336625 ATGCTAAATTAGAACACTGAAGG - Intronic
1004573066 6:16866885-16866907 AAGAAAAATTCTTACACTTGGGG + Intergenic
1004924928 6:20407045-20407067 ATGAAAATTTCAAGCACTGAGGG - Intronic
1004935715 6:20506193-20506215 ATGTCAAATACTAACACTGGGGG - Intergenic
1005052048 6:21693928-21693950 ATGAAATATTGTTCCACTGATGG + Intergenic
1005326945 6:24711314-24711336 ACGAAATATTCTAACAGTCAGGG + Intronic
1005443897 6:25901169-25901191 ATGTAAAATCCTAACAATGGGGG + Intergenic
1005762113 6:28977124-28977146 ATGAAGAGTTCTAACGCTGTAGG - Intergenic
1006969045 6:38021469-38021491 ATGAAAAATTCTAGTCCTGGGGG - Intronic
1007905353 6:45454345-45454367 TGGAAAAAATCTGACACTGAAGG + Intronic
1009661316 6:66614697-66614719 ATGAAAAATTATAATTATGAAGG + Intergenic
1010609209 6:77932337-77932359 ATACAAAATTATATCACTGAAGG - Intergenic
1010804785 6:80222679-80222701 ATTAAAAATTACAACACTAAGGG - Intronic
1011025334 6:82862647-82862669 AACAAGAATTCCAACACTGAAGG + Intergenic
1012071501 6:94624390-94624412 TTGAACAATTCAGACACTGAGGG - Intergenic
1012183044 6:96178668-96178690 ATAAATAATTCTAAAAATGATGG - Intronic
1012206713 6:96470146-96470168 ATTAAAAATTCTACCCCTGGTGG + Intergenic
1012631259 6:101470517-101470539 AAGAAAAATTATCACATTGAAGG - Intronic
1012913958 6:105148270-105148292 ATGCAAAATGCTAAAACTGCTGG - Intergenic
1013650647 6:112191458-112191480 ATAAAAATTTCTATCCCTGATGG + Intronic
1013862322 6:114650576-114650598 ATGAAAAATTCAGAAACTAATGG - Intergenic
1013933233 6:115561126-115561148 ATGGAAAATTATGACTCTGAAGG + Intergenic
1014136764 6:117898380-117898402 AAAAAAAATCCTAAAACTGATGG + Intergenic
1014140775 6:117939534-117939556 TTGAAATTTTCTGACACTGAAGG + Intronic
1014955837 6:127614806-127614828 AAGAAAAATCCTAACCCTGGTGG + Intergenic
1015511625 6:134043481-134043503 AAGAAAATTTCTAAAAGTGACGG - Intronic
1015945108 6:138491563-138491585 ATGAAGGATTCAAACAATGATGG + Intronic
1016057118 6:139589965-139589987 ATGAAAAATTCTATCTTTGGTGG + Intergenic
1016839768 6:148514435-148514457 ATGAAAAAACCCAGCACTGAAGG + Exonic
1017080219 6:150661302-150661324 ATAAAAAATCCTAATCCTGAAGG - Intronic
1017611592 6:156192252-156192274 ATGAAACTTTATAACGCTGAAGG - Intergenic
1019006907 6:168805995-168806017 ATAAAAAAGTCTCACACTGCAGG - Intergenic
1020337675 7:7074793-7074815 ATGAAGAATAGTATCACTGAGGG - Intergenic
1020659667 7:10966878-10966900 AGGACAAATTCTGACCCTGAAGG - Intergenic
1020679983 7:11224539-11224561 ATAGAAAATTATAGCACTGAGGG + Intergenic
1021253989 7:18367032-18367054 ATGAAAAAATCTCATACAGATGG - Intronic
1021739374 7:23670342-23670364 ATGAATAACTCAAAGACTGATGG - Intergenic
1022931885 7:35125994-35126016 AAGAAAAATTCAAATAATGAAGG + Intergenic
1023323102 7:39021902-39021924 AAGAAAAATGCTAAAACTGTGGG - Intronic
1023418576 7:39954034-39954056 ATGAAGAATTCTAACAATTTGGG - Intronic
1023536992 7:41224165-41224187 ATGAAAAACTTTAAAAATGATGG + Intergenic
1024102517 7:46047297-46047319 GTGAAAAATTGTAGCACTTAGGG - Intergenic
1026325012 7:69301536-69301558 ATGAAGAAATCAAACACAGAAGG + Intergenic
1026686928 7:72518955-72518977 ATGTAAAATGATAACATTGAGGG - Intergenic
1026802310 7:73408061-73408083 ATGAAAAATTCAAATCCTCAAGG + Intergenic
1027644711 7:80782800-80782822 ATGAAGAATTGTAACAATGTAGG - Intronic
1027955087 7:84867412-84867434 ACGGAAAGTTCTAACACTGGTGG - Intergenic
1028289915 7:89052322-89052344 CAGAAAAATTATAAAACTGATGG - Intronic
1029827772 7:103218494-103218516 AAGAAAAATTCAAATAATGAAGG + Intergenic
1030067365 7:105670392-105670414 ATTAAATATTTTAACAATGAGGG - Intronic
1030653681 7:112143046-112143068 ATGTAAAATGCTTACACTGGGGG + Intronic
1030981583 7:116191204-116191226 AAGAAAAAGTCAATCACTGAAGG - Intergenic
1031147079 7:118008362-118008384 ATGCAGAATTCTTACACTAAGGG - Intergenic
1031261059 7:119520819-119520841 CTGAAATATTAAAACACTGATGG - Intergenic
1032762624 7:134958393-134958415 AAAAAAAATTCTAACACTCCTGG - Intronic
1035548997 8:505789-505811 ATGAAAAACTCTCAAACTGCAGG + Intronic
1035855395 8:2970354-2970376 ATGAAATATTCTATCAAAGATGG - Intronic
1036378512 8:8220731-8220753 ATTAAAATTTCTAAAATTGATGG + Intergenic
1036851061 8:12201887-12201909 ATTAAAATTTCTAAAATTGATGG - Intergenic
1036872425 8:12444168-12444190 ATTAAAATTTCTAAAATTGATGG - Intergenic
1037155517 8:15694567-15694589 ATGACAACTTCTAAGACTGAAGG - Intronic
1038725477 8:30078308-30078330 AAGAAAAGTTCCCACACTGAAGG + Intronic
1038799854 8:30739672-30739694 ATGCACAATTTTAACACTGGGGG + Intronic
1039607302 8:38891944-38891966 ATGACAACTTCAGACACTGAAGG + Intergenic
1040922943 8:52643854-52643876 ATGAATAATGCTAACAATGCTGG + Intronic
1041029419 8:53720870-53720892 ATGAAAAATTTGCACACTAAAGG - Intronic
1041438905 8:57872893-57872915 AGGAAAAATTCTAATACTTCTGG + Intergenic
1041443124 8:57919797-57919819 ATCAAAAATACTAAAACAGAAGG + Intergenic
1042538844 8:69887333-69887355 ATGTAAAATTCACCCACTGATGG + Intergenic
1043226124 8:77733255-77733277 ATGCAAAATTAAAACATTGATGG + Intergenic
1044892606 8:96853260-96853282 ATGAAACATTCTAAAATTCAAGG + Intronic
1045226169 8:100248000-100248022 AAGAAAAATTCTGCCACTGCAGG + Intronic
1045530434 8:102980124-102980146 AACAAAAATTCTAACAGGGAGGG - Intergenic
1045876793 8:106991240-106991262 ATTAAAAATTCTAACAGATAGGG + Intergenic
1046202792 8:110949892-110949914 ATGAAACATGCTACCACTGCTGG - Intergenic
1046858312 8:119061316-119061338 AAGAAAATTTATAATACTGATGG + Intronic
1047056523 8:121170636-121170658 ATGAGAAATTCTAACACTTAAGG - Intergenic
1047918654 8:129609916-129609938 ATCCAAAATTGTAACACTAAAGG + Intergenic
1048253298 8:132885222-132885244 ATGTAAAATTCAAACACCAAGGG - Intronic
1048839682 8:138554034-138554056 ATGAAAAATACTAATTCAGAGGG + Intergenic
1050318134 9:4424129-4424151 AAGAAAAACTTTTACACTGATGG - Intergenic
1051828186 9:21245436-21245458 ATGATAAATTCTAAAGGTGATGG - Intergenic
1052061848 9:23969639-23969661 ATAAAAAATTTTAATATTGATGG + Intergenic
1052110106 9:24571722-24571744 ATGGAAATTTCTAACACACATGG - Intergenic
1052667187 9:31510037-31510059 ATGAAAATGTCTACCACTAATGG + Intergenic
1052739425 9:32379157-32379179 ATGATTAATTCTTACTCTGAGGG - Intergenic
1055674798 9:78646576-78646598 ATGACCAATTCTAACAATCATGG - Intergenic
1058050343 9:100399973-100399995 ATTAAAAACTATAACACAGAAGG - Intergenic
1058162955 9:101590179-101590201 ATGAAAAATTCTAACACTGAAGG - Intronic
1058444110 9:105038987-105039009 AAAAAAAATTCCAAAACTGAAGG - Intergenic
1059015182 9:110507621-110507643 AGGAAAAATTAAAACACGGAAGG - Intronic
1059760952 9:117336869-117336891 ATGAAAAGTTCTGACACAAAGGG + Intronic
1059883191 9:118715094-118715116 ATGAAGAAAGTTAACACTGAAGG + Intergenic
1060398573 9:123333706-123333728 ATTCAAAATTATATCACTGACGG - Intergenic
1061520335 9:131113962-131113984 AGGAAAACTTCTAGCAGTGAGGG - Intronic
1186008121 X:5096918-5096940 ATGAAAAACTATAGCACTTAAGG + Intergenic
1186026050 X:5313720-5313742 TTTAAAAAATCTAACACTAACGG + Intergenic
1187300219 X:18041648-18041670 GTGAAAAATCCTATCACTCACGG + Intergenic
1187567731 X:20468810-20468832 ATCAAAAATTCTAAGCCAGATGG + Intergenic
1188464930 X:30469078-30469100 TTGAAAATGGCTAACACTGAGGG - Intergenic
1189657231 X:43257574-43257596 ATGACGAATTGTAACAATGAAGG + Intergenic
1190572480 X:51797988-51798010 ATGAAAAATACTAATACTGGTGG + Intergenic
1192464767 X:71346664-71346686 ATGCATAATTCTAACACTTTGGG + Intergenic
1193849114 X:86514158-86514180 ATGTAAAATTCTATCACTTTTGG + Intronic
1195510391 X:105709472-105709494 TTGGAAAATTCTAACACTCTAGG + Intronic
1195751754 X:108166565-108166587 ATGAAAATTTATAAAAGTGATGG + Intronic
1195806863 X:108783043-108783065 ATTAAAAATTTTCACTCTGATGG + Intergenic
1195987673 X:110648162-110648184 AACAAAAATTATAACACTGTCGG + Intergenic
1197242455 X:124134506-124134528 AAGAAAAAACCTAAAACTGAGGG + Intronic
1198491226 X:137143770-137143792 ATGAAAAAAACTAAGACTCAAGG + Intergenic
1198581400 X:138068816-138068838 ATGATAAATTCTTAAAATGATGG - Intergenic
1200373098 X:155748625-155748647 AGGAAGAATTCTGACACTGAAGG + Intergenic
1200794322 Y:7326621-7326643 AAGAATAATTTTAACACTGAGGG - Intergenic
1200848250 Y:7854513-7854535 ATAAAAAATTCATACACAGATGG - Intergenic