ID: 1058165215

View in Genome Browser
Species Human (GRCh38)
Location 9:101611349-101611371
Sequence CTCCACAGGGTCTCCTTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058165208_1058165215 23 Left 1058165208 9:101611303-101611325 CCAGTCTTTGCCTTTGTTGTCAC 0: 2
1: 3
2: 31
3: 127
4: 675
Right 1058165215 9:101611349-101611371 CTCCACAGGGTCTCCTTATAAGG No data
1058165210_1058165215 13 Left 1058165210 9:101611313-101611335 CCTTTGTTGTCACGTGGACTTTT 0: 1
1: 0
2: 1
3: 23
4: 196
Right 1058165215 9:101611349-101611371 CTCCACAGGGTCTCCTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058165215 Original CRISPR CTCCACAGGGTCTCCTTATA AGG Intronic
No off target data available for this crispr