ID: 1058166171

View in Genome Browser
Species Human (GRCh38)
Location 9:101621768-101621790
Sequence CTGAAGATAAAGGTGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058166164_1058166171 12 Left 1058166164 9:101621733-101621755 CCTACCACTGTCTTTTGACAAGA 0: 1
1: 0
2: 1
3: 27
4: 247
Right 1058166171 9:101621768-101621790 CTGAAGATAAAGGTGGAAAATGG No data
1058166163_1058166171 16 Left 1058166163 9:101621729-101621751 CCATCCTACCACTGTCTTTTGAC 0: 1
1: 0
2: 1
3: 23
4: 238
Right 1058166171 9:101621768-101621790 CTGAAGATAAAGGTGGAAAATGG No data
1058166165_1058166171 8 Left 1058166165 9:101621737-101621759 CCACTGTCTTTTGACAAGATAGA 0: 1
1: 0
2: 0
3: 17
4: 218
Right 1058166171 9:101621768-101621790 CTGAAGATAAAGGTGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058166171 Original CRISPR CTGAAGATAAAGGTGGAAAA TGG Intronic
No off target data available for this crispr