ID: 1058167003

View in Genome Browser
Species Human (GRCh38)
Location 9:101631596-101631618
Sequence CAGGCTCAGAATTCTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058166994_1058167003 17 Left 1058166994 9:101631556-101631578 CCTTTCCAAAGCATGGAAGGAAT 0: 1
1: 0
2: 2
3: 11
4: 220
Right 1058167003 9:101631596-101631618 CAGGCTCAGAATTCTGCTGGAGG No data
1058166991_1058167003 30 Left 1058166991 9:101631543-101631565 CCAGCACATCGTTCCTTTCCAAA 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1058167003 9:101631596-101631618 CAGGCTCAGAATTCTGCTGGAGG No data
1058166996_1058167003 12 Left 1058166996 9:101631561-101631583 CCAAAGCATGGAAGGAATCAGGG 0: 1
1: 0
2: 1
3: 15
4: 226
Right 1058167003 9:101631596-101631618 CAGGCTCAGAATTCTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058167003 Original CRISPR CAGGCTCAGAATTCTGCTGG AGG Intronic
No off target data available for this crispr