ID: 1058168802

View in Genome Browser
Species Human (GRCh38)
Location 9:101653150-101653172
Sequence CATCACATGCCACTTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058168801_1058168802 7 Left 1058168801 9:101653120-101653142 CCAAGTATGAATGGTTATTAAAA 0: 1
1: 0
2: 4
3: 39
4: 389
Right 1058168802 9:101653150-101653172 CATCACATGCCACTTGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058168802 Original CRISPR CATCACATGCCACTTGTGTC AGG Intronic
No off target data available for this crispr