ID: 1058170005

View in Genome Browser
Species Human (GRCh38)
Location 9:101669277-101669299
Sequence GGTTCAATCCAGAGAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058170001_1058170005 -1 Left 1058170001 9:101669255-101669277 CCAGCTCACTTAGAGGGGCCCTG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1058170005 9:101669277-101669299 GGTTCAATCCAGAGAGAACATGG No data
1058169995_1058170005 28 Left 1058169995 9:101669226-101669248 CCTATTGGGCTGGACTAATTTTC 0: 1
1: 0
2: 0
3: 8
4: 134
Right 1058170005 9:101669277-101669299 GGTTCAATCCAGAGAGAACATGG No data
1058170000_1058170005 0 Left 1058170000 9:101669254-101669276 CCCAGCTCACTTAGAGGGGCCCT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1058170005 9:101669277-101669299 GGTTCAATCCAGAGAGAACATGG No data
1058169999_1058170005 1 Left 1058169999 9:101669253-101669275 CCCCAGCTCACTTAGAGGGGCCC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1058170005 9:101669277-101669299 GGTTCAATCCAGAGAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058170005 Original CRISPR GGTTCAATCCAGAGAGAACA TGG Intronic
No off target data available for this crispr