ID: 1058174657

View in Genome Browser
Species Human (GRCh38)
Location 9:101723047-101723069
Sequence ATGTGTTGTGGGAGGCACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058174648_1058174657 15 Left 1058174648 9:101723009-101723031 CCCAAATCTCAACTTGAATTGTA 0: 652
1: 8787
2: 10362
3: 8510
4: 7363
Right 1058174657 9:101723047-101723069 ATGTGTTGTGGGAGGCACGCAGG No data
1058174646_1058174657 19 Left 1058174646 9:101723005-101723027 CCCACCCAAATCTCAACTTGAAT 0: 645
1: 9478
2: 10966
3: 9597
4: 7163
Right 1058174657 9:101723047-101723069 ATGTGTTGTGGGAGGCACGCAGG No data
1058174645_1058174657 20 Left 1058174645 9:101723004-101723026 CCCCACCCAAATCTCAACTTGAA 0: 614
1: 9434
2: 11285
3: 8897
4: 6595
Right 1058174657 9:101723047-101723069 ATGTGTTGTGGGAGGCACGCAGG No data
1058174647_1058174657 18 Left 1058174647 9:101723006-101723028 CCACCCAAATCTCAACTTGAATT 0: 641
1: 9475
2: 11346
3: 8916
4: 8047
Right 1058174657 9:101723047-101723069 ATGTGTTGTGGGAGGCACGCAGG No data
1058174649_1058174657 14 Left 1058174649 9:101723010-101723032 CCAAATCTCAACTTGAATTGTAT 0: 572
1: 833
2: 8787
3: 10494
4: 9511
Right 1058174657 9:101723047-101723069 ATGTGTTGTGGGAGGCACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058174657 Original CRISPR ATGTGTTGTGGGAGGCACGC AGG Intronic
No off target data available for this crispr