ID: 1058175114

View in Genome Browser
Species Human (GRCh38)
Location 9:101726424-101726446
Sequence CTGTACCACCAGAAGGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058175114 Original CRISPR CTGTACCACCAGAAGGTGTT TGG (reversed) Intronic
902836024 1:19047318-19047340 CTCTACCCCAAGCAGGTGTTTGG + Intergenic
903442186 1:23396411-23396433 CTGTTGCACCAAAAGGTGTTTGG - Intronic
905517745 1:38574528-38574550 CTGTACCACAAGTGGGTCTTAGG + Intergenic
905646226 1:39626632-39626654 CTGTAGGACCAGGGGGTGTTGGG + Exonic
907408739 1:54270108-54270130 TTGTACCAGCATAAGGTGTGTGG - Intronic
907624852 1:56020032-56020054 TTGTCCCACTAGAAGGTCTTCGG + Intergenic
909794258 1:79713262-79713284 TTATACCACCAGTGGGTGTTGGG + Intergenic
911275200 1:95852048-95852070 CTACACCACCAGTAGGTGATAGG + Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
920324463 1:205151810-205151832 CTGTCCCACTGGAAGGTTTTCGG + Intronic
920806949 1:209243602-209243624 CTGCCCCACCACAAGGTGTTTGG - Intergenic
924020230 1:239773205-239773227 CTGTACCACCGAAAGGTTGTAGG + Intronic
924821764 1:247498899-247498921 CAGTCCCACCAGAGGGTGATGGG + Intergenic
1063957170 10:11277796-11277818 CTGTAACATCAGGTGGTGTTTGG - Intronic
1067913419 10:50370834-50370856 TTGTCCCACCAGAAGGTCTTCGG + Intronic
1068253958 10:54483594-54483616 CTTTACCAACAGAAGGTGATAGG + Intronic
1075307126 10:121377975-121377997 CAGCCCCACCAGAAGGGGTTGGG - Intergenic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1082833993 11:57639034-57639056 CTGCACCTCCAGAAGTTGTAGGG + Intergenic
1083235860 11:61350359-61350381 CTGCACCACCAGGAGCTCTTGGG + Exonic
1085698951 11:78729393-78729415 GTCTACAACCAGAAGGTGTTTGG - Exonic
1090169151 11:124582905-124582927 CTGTACCAACAGAAAGAGTCTGG - Intergenic
1090291394 11:125548308-125548330 CTATATCACCATAAGTTGTTTGG + Intergenic
1093291925 12:17336652-17336674 CTTTACCACAAAAAAGTGTTGGG - Intergenic
1093628450 12:21380377-21380399 CTCTAGCACCAGAGGTTGTTGGG - Intronic
1093801312 12:23376140-23376162 CTGGACCACCAAAATGGGTTTGG - Intergenic
1103316601 12:120061068-120061090 CTGCAACACCAGATGGTATTTGG + Intronic
1106411199 13:29512850-29512872 CTGTGCCCCCAGAAGGTTCTTGG - Exonic
1113444960 13:110358317-110358339 TTGTCCCACCAGAAGGTCTTCGG + Intronic
1117235855 14:53773956-53773978 CTGTACTCCCAGAATTTGTTGGG + Intergenic
1122271704 14:100571183-100571205 CTGGACCACCAGAAAGAGGTAGG - Intronic
1124827586 15:33114060-33114082 CTGCTCCAAGAGAAGGTGTTGGG - Intronic
1125730068 15:41888075-41888097 CTGTCCCGCCAGGAGGAGTTTGG - Exonic
1126112016 15:45180972-45180994 CTGTGTCACCAGAAGCTGCTTGG + Intronic
1126308025 15:47283351-47283373 CTGTGACACCACAAGCTGTTTGG + Intronic
1128698959 15:69789978-69790000 CAGGACCACCAGAAAGTCTTTGG + Intergenic
1129055443 15:72816803-72816825 CTGTTACACCAAAAGGTGTGGGG + Intergenic
1129125453 15:73436751-73436773 CTGCACCTCCAGCAGATGTTAGG - Intergenic
1131907335 15:97157276-97157298 CTGTAGCACTGGAAGGTGTCAGG - Intergenic
1132510375 16:337941-337963 CATTAGCTCCAGAAGGTGTTCGG - Intronic
1134569639 16:15280284-15280306 CTGTACAACCACAAGGGATTTGG - Intergenic
1134732740 16:16475765-16475787 CTGTACAACCACAAGGGATTTGG + Intergenic
1134934702 16:18236203-18236225 CTGTACAACCACAAGGGATTTGG - Intergenic
1135641595 16:24124315-24124337 AGGAACCATCAGAAGGTGTTGGG + Intronic
1137248192 16:46722353-46722375 CTGTCCCCCCAGAGGGTGTGAGG + Intronic
1145786905 17:27599972-27599994 TTGTCCCACCGGAAGGTCTTCGG + Intronic
1146154349 17:30508011-30508033 CTGTACCATAAGATGCTGTTTGG - Intronic
1147878755 17:43640640-43640662 CTGCAACACCAGCTGGTGTTGGG + Exonic
1148289741 17:46434372-46434394 TTGTACCAGCATAATGTGTTGGG + Intergenic
1148311909 17:46651944-46651966 TTGTACCAGCATAATGTGTTGGG + Intronic
1150069620 17:62139916-62139938 GTGGACCACCAGCAGGTGGTGGG + Intergenic
1153611200 18:6887042-6887064 CTTTACCACCAAAAGCTGTCAGG + Intronic
1153770302 18:8409796-8409818 CTGTCGCAGTAGAAGGTGTTAGG - Intergenic
1155509938 18:26566427-26566449 CAGGACAGCCAGAAGGTGTTCGG - Intronic
1163847760 19:19646936-19646958 CTGTACCACCTGGAGGGGTCTGG + Intronic
925415047 2:3664076-3664098 ATGTCCCACCACAAGGTGCTGGG - Intronic
929756592 2:44770893-44770915 CTGTACCACCATCAGTTCTTGGG + Intronic
931368490 2:61640274-61640296 GTGTAAAAACAGAAGGTGTTGGG + Intergenic
935716319 2:105942488-105942510 CTGTAACAGCAGGAAGTGTTAGG - Intergenic
938405378 2:131029988-131030010 CTGTGACACCAGATGGTGTGAGG + Intronic
940885278 2:158984636-158984658 CAGTACCACTGCAAGGTGTTAGG + Intronic
947103486 2:226646006-226646028 CTTTACCACCAGTAGGCGTAGGG + Intergenic
948295153 2:236855222-236855244 CTGTAGCGCCAGGAGGTGTTTGG - Intergenic
1174496519 20:50948089-50948111 CTGTACCTCCCAAAGCTGTTTGG - Intronic
1177243773 21:18495647-18495669 CTCTACCACCATATGGTGTCTGG + Intergenic
1181325255 22:22039936-22039958 CTCTTCCACCAGATGGTGTCTGG - Intergenic
1182760912 22:32721651-32721673 CTGTACCACCAGTGGGAGCTGGG - Intronic
1183617401 22:38954023-38954045 CTTTGCCACCAGAAGGAGTTGGG - Intronic
1185395619 22:50585963-50585985 ATGTCCCACCAGCAGGTGCTCGG - Intronic
949326178 3:2867329-2867351 CTGTACATCCAGAAGTTATTTGG - Intronic
950181104 3:10914067-10914089 CTGTCCCACCAGCAGGGGTATGG - Intronic
963074919 3:141336861-141336883 CTCACCCATCAGAAGGTGTTTGG - Intronic
963440927 3:145338669-145338691 CTGTACCACCAGAAAGCCTCAGG - Intergenic
963575066 3:147049925-147049947 ATGTAGCACAAGAAGATGTTGGG + Intergenic
964481042 3:157138610-157138632 CTGTATAACCAGAAGCTCTTGGG - Intergenic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
969894789 4:10293278-10293300 CCGTATGAGCAGAAGGTGTTAGG - Intergenic
973263129 4:48185096-48185118 CTGTAACCCTAGAAGATGTTGGG - Intronic
977676346 4:99752195-99752217 CTGTCCCACTGGAAGGTCTTTGG + Intergenic
978229378 4:106380161-106380183 CTGTACCACCAGCAATTATTAGG - Intergenic
981513514 4:145583026-145583048 CTGAACCACTGGAAGGAGTTTGG - Intergenic
982515492 4:156343068-156343090 CTGTACCACAAGAAGTTGGAGGG - Intergenic
986238746 5:5937811-5937833 CAGAACCCCCAGAAGGTGTCGGG - Intergenic
988391493 5:30639488-30639510 AAGGACCACAAGAAGGTGTTAGG - Intergenic
989076426 5:37568162-37568184 CTGTACCACAAGAAGGAGCCAGG - Intronic
989267211 5:39489611-39489633 CTGTACAACCTGGAGTTGTTTGG - Intergenic
993748645 5:91636542-91636564 CTGTACCACCAGAGTGCGTGGGG + Intergenic
994123862 5:96148566-96148588 CTGACTCACCAGAACGTGTTGGG - Intergenic
1004851739 6:19706504-19706526 CTGTCCCTCCAGAAAGGGTTTGG + Intergenic
1007131280 6:39476509-39476531 CTGCACCATCAGAAGGAGCTGGG + Intronic
1007719719 6:43877949-43877971 CTGTTCCACCAGATGCTGCTGGG + Intergenic
1012434681 6:99202981-99203003 CTGTAGTACCTGAAGGTGATGGG - Intergenic
1013413691 6:109905529-109905551 CTCTACCAGCTGAAGGTGGTAGG + Intergenic
1014996612 6:128153529-128153551 CTGTACTATCAGAAGGTGTCTGG + Intronic
1015261389 6:131241430-131241452 CTGTACCACCAATTGGTGTAGGG - Intronic
1015538750 6:134293917-134293939 GTGTACATCCAGAAGGTGCTAGG + Intronic
1019788001 7:2991500-2991522 CCTTCCCACCAGAAGCTGTTGGG - Intronic
1023652688 7:42388277-42388299 CTGTACCTACAGAAGGGGATGGG - Intergenic
1023917558 7:44601476-44601498 CTGTACCTAGAGAAGGTATTGGG - Intergenic
1027197782 7:76043026-76043048 CTGCACCCCCAGAATTTGTTGGG + Intronic
1030713032 7:112775170-112775192 CTGTACCTGCAGAAGTTGGTGGG + Exonic
1031380585 7:121080821-121080843 CTCTACCACCAGAAGGAGACTGG - Intronic
1035952260 8:4035505-4035527 TTGTCCCACCAGAAGGTCTTCGG - Intronic
1039565927 8:38552687-38552709 CTTTAGAAGCAGAAGGTGTTAGG - Intergenic
1047136622 8:122086021-122086043 CTGTCCCACTGGAAGGTCTTTGG - Intergenic
1050577217 9:7009209-7009231 CTTTACCTCCAGAATATGTTTGG - Intronic
1056069749 9:82973814-82973836 CTGTCCCAAGAGAAAGTGTTTGG - Intergenic
1058175114 9:101726424-101726446 CTGTACCACCAGAAGGTGTTTGG - Intronic
1060230553 9:121822377-121822399 GTGTATCACCAGGAGGTGTGAGG + Exonic
1061327108 9:129870465-129870487 CTGTACCCCCAGCTGGTTTTGGG + Exonic
1187428541 X:19201134-19201156 GTGCACCACCACAAAGTGTTGGG + Intergenic
1188979571 X:36714901-36714923 AAGTACCACCAGAAGGTGCATGG + Intergenic
1191724542 X:64265731-64265753 CTGTAAAACTAAAAGGTGTTTGG + Intergenic
1192434556 X:71135080-71135102 CTGTGCCTGCAGAAGGAGTTGGG + Exonic
1192709187 X:73562434-73562456 CTGTACTGCCTGAAGTTGTTTGG - Intergenic
1195296468 X:103483038-103483060 TTGTCTCACCAGAAGGTCTTTGG + Intergenic
1196551125 X:117026861-117026883 CTGTAGCACCAGAGTGTGGTTGG + Intergenic
1200983766 Y:9285667-9285689 CAGCACCTCCAGAAGGTGGTGGG + Intergenic