ID: 1058175208

View in Genome Browser
Species Human (GRCh38)
Location 9:101727844-101727866
Sequence CTGTGTCTGTGGCCAGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058175201_1058175208 28 Left 1058175201 9:101727793-101727815 CCTAGGATGCTTCAGCCTAAAGC 0: 1
1: 0
2: 0
3: 12
4: 106
Right 1058175208 9:101727844-101727866 CTGTGTCTGTGGCCAGGTGAAGG No data
1058175203_1058175208 13 Left 1058175203 9:101727808-101727830 CCTAAAGCTGTATTTTGGAGACC 0: 1
1: 0
2: 1
3: 14
4: 185
Right 1058175208 9:101727844-101727866 CTGTGTCTGTGGCCAGGTGAAGG No data
1058175205_1058175208 -8 Left 1058175205 9:101727829-101727851 CCACTAGATGGCTCTCTGTGTCT 0: 1
1: 0
2: 3
3: 17
4: 255
Right 1058175208 9:101727844-101727866 CTGTGTCTGTGGCCAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058175208 Original CRISPR CTGTGTCTGTGGCCAGGTGA AGG Intronic
No off target data available for this crispr