ID: 1058175558

View in Genome Browser
Species Human (GRCh38)
Location 9:101732533-101732555
Sequence AAAAAACTAGGTTCCTAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058175558_1058175563 29 Left 1058175558 9:101732533-101732555 CCTACTTAGGAACCTAGTTTTTT 0: 1
1: 0
2: 3
3: 11
4: 173
Right 1058175563 9:101732585-101732607 TTTTTAAGAGAAAAAAATGAGGG No data
1058175558_1058175562 28 Left 1058175558 9:101732533-101732555 CCTACTTAGGAACCTAGTTTTTT 0: 1
1: 0
2: 3
3: 11
4: 173
Right 1058175562 9:101732584-101732606 TTTTTTAAGAGAAAAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058175558 Original CRISPR AAAAAACTAGGTTCCTAAGT AGG (reversed) Intronic
900282861 1:1882583-1882605 AAAAATCTAGCTTCATAAATGGG + Intronic
901540498 1:9912051-9912073 AAAAAAATTGGTCCCCAAGTGGG + Intergenic
901706747 1:11079355-11079377 AAAAAACAGGCTTGCTAAGTTGG + Intronic
903821804 1:26108880-26108902 AAAAAAATAGTTGCCTATGTGGG - Intergenic
907353473 1:53852784-53852806 AAAAAAAAAAGTTTCTAAGTAGG + Intronic
908965919 1:69762704-69762726 AACTCACTAGGATCCTAAGTAGG + Intronic
909215941 1:72888854-72888876 AAAACACTATGTTCCAAAATTGG - Intergenic
910016932 1:82536526-82536548 AAAAAACAGGGGTGCTAAGTAGG - Intergenic
910116138 1:83734320-83734342 AAAAACCTAGGCTCCTAAATGGG - Intergenic
911653439 1:100416258-100416280 AAAGAATTAGATTCCCAAGTTGG - Intronic
912402134 1:109403142-109403164 AAAAAACTAGGGTCAGAAGATGG + Intronic
912466448 1:109877905-109877927 TAAAAACTAGGTTCCTCACACGG - Intergenic
913594284 1:120358798-120358820 GAAAAAATAGATTCCCAAGTGGG - Intergenic
914092976 1:144520185-144520207 GAAAAAATAGATTCCCAAGTGGG + Intergenic
914305551 1:146413687-146413709 GAAAAAATAGATTCCCAAGTGGG - Intergenic
914596506 1:149159119-149159141 GAAAAAATAGATTCCCAAGTGGG + Intergenic
915077412 1:153320466-153320488 AATAAACCAGGTACCTCAGTTGG + Intergenic
915822919 1:159044525-159044547 AAAAAATTAGGTTACTGAATGGG + Intronic
916414927 1:164583575-164583597 AAGAAACATGGTTCCTAAGAAGG + Intronic
916852061 1:168713825-168713847 AGGAAACTAGGTTCCCAAATAGG + Intronic
918465082 1:184812818-184812840 AAAGAACTTGCTTCCTAAGCAGG - Intronic
923067075 1:230527626-230527648 GATGAACTAGGTTCCTCAGTTGG + Intergenic
923830812 1:237554490-237554512 GTAAATCTAGCTTCCTAAGTAGG + Intronic
924682303 1:246249497-246249519 AAAAAACTAGGATCCATACTGGG - Intronic
1063752127 10:8961773-8961795 AAAGAACTAGCTTCCTTGGTTGG + Intergenic
1063895931 10:10681853-10681875 AACAAACTTGGTTCCAAAATGGG - Intergenic
1068930263 10:62582134-62582156 AAATAAGTAGGTTGCTTAGTTGG + Intronic
1069468486 10:68663990-68664012 AAAAAAGGAGGTACCTACGTTGG - Intronic
1069996744 10:72346838-72346860 AAAAAAATGGATTCATAAGTTGG - Intronic
1070203961 10:74237277-74237299 AAAAAAGTGGTTTCCTAAGATGG - Intronic
1070321337 10:75356991-75357013 AAAAAACAGGGTTCCTCAATTGG + Intergenic
1071427754 10:85576285-85576307 AAAAAACTAGGTTTAGAAGGAGG - Intergenic
1072340280 10:94440812-94440834 AAAAAAATAGGTACTTAATTTGG + Intronic
1074409649 10:113215638-113215660 AAAAAACTAGTTTCTTAAAATGG - Intergenic
1074677321 10:115866573-115866595 CAAAAACTAGGTTCATATCTTGG - Intronic
1075576620 10:123582395-123582417 AAGAAACGAGGTGCCTTAGTAGG + Intergenic
1080518712 11:33047530-33047552 AATAAACAAAGGTCCTAAGTGGG - Intronic
1083514919 11:63247870-63247892 AAAAAGCAAGGTCCCTATGTGGG + Intronic
1084540647 11:69784419-69784441 AAAAAACTAATTTCCTAGGCTGG + Intergenic
1086209440 11:84300958-84300980 AAAACACTAGGTTAATAAATGGG - Intronic
1087743741 11:101918597-101918619 AGAAAACTTGGCTCCTAAGGGGG - Intronic
1087975611 11:104542516-104542538 AAAAAAATATGTTTCTAATTTGG + Intergenic
1089410593 11:118238575-118238597 AAACACCCAGGTTCCTAAATGGG - Intronic
1091713430 12:2759310-2759332 ACTAAACTAGGTTTCTAAGGTGG + Intergenic
1093819735 12:23599099-23599121 AAAAAAATAGGTTCCCTAATAGG + Intronic
1094246611 12:28304007-28304029 AAAAAAATAATTTCCGAAGTAGG + Intronic
1094402113 12:30073335-30073357 ACAAAACTAGCTTCCTAAACTGG + Intergenic
1095475468 12:42582954-42582976 AATAATCTAAGTTCCTAATTTGG - Intronic
1096268850 12:50147421-50147443 AAAAAAATAGGTACCTAGGGTGG + Intronic
1096403746 12:51327765-51327787 AAAAAAAAAGGTTCCCGAGTGGG - Intergenic
1097206678 12:57327831-57327853 AAAAAAGTAGGTTCTTGAGATGG + Intronic
1099744288 12:86683035-86683057 AATAAACTAGGATCCTGAGCAGG + Intronic
1100375198 12:94008361-94008383 GAAGAACTAGGTACCTCAGTTGG + Intergenic
1105721560 13:23121275-23121297 AAAAAACTAGATGCCTCAGAGGG - Intergenic
1105807785 13:23967250-23967272 AATAAACTCTGTTCCTAAGTAGG - Intergenic
1109009639 13:56923713-56923735 AAAAAACCAGGTTACTAAAAAGG + Intergenic
1110147761 13:72213287-72213309 AGAAAACTAGTTTCCAAAATTGG + Intergenic
1114655898 14:24315436-24315458 CAAAGACTAGTTTCCTAACTGGG - Intronic
1116248510 14:42451683-42451705 TAAAAACAAGTTTCCTAAGTGGG + Intergenic
1118670140 14:68116362-68116384 AAGAAACTAGGTTTTCAAGTTGG + Intronic
1125016549 15:34942907-34942929 AATAAACTAGTTTGGTAAGTTGG + Intronic
1125228407 15:37423370-37423392 AAAAGACTAGTTTCCTGAATGGG - Intergenic
1125473287 15:40025266-40025288 AAAAAACCAGATTCCTTGGTTGG - Intronic
1125736983 15:41933814-41933836 AAAATCCTAGCTTCCGAAGTAGG + Intronic
1135260649 16:20977597-20977619 CAAAACCTATGTTCCTAACTAGG - Intronic
1140360445 16:74339529-74339551 AGAGAACAAGGTTACTAAGTGGG + Intergenic
1140897854 16:79340874-79340896 AAATAACTAAATTGCTAAGTGGG + Intergenic
1144647114 17:16982648-16982670 AAAAAAATACGATCTTAAGTGGG - Intergenic
1147136942 17:38439765-38439787 AAAAAAAAAAGTTCCTAAGCAGG - Intronic
1147479198 17:40742984-40743006 AAAAAATTAGGTAGGTAAGTAGG - Intergenic
1150579005 17:66455227-66455249 AAAGAACTAGGCTCCAAATTCGG - Intronic
1156818563 18:41342318-41342340 AAATTACTAGGCTGCTAAGTGGG + Intergenic
1157344810 18:46817445-46817467 ACAAAAATAGGATCCTCAGTGGG - Intronic
1157907920 18:51586006-51586028 AAAAAATTAGTTTGCTAATTCGG - Intergenic
1165239993 19:34458600-34458622 GAAAAACCAGGTTCCTAAAAAGG + Intronic
926763919 2:16305663-16305685 AAAAAACTAAGTGACTAAGTAGG + Intergenic
928304550 2:30156802-30156824 AAAAAGTTTGATTCCTAAGTGGG + Intronic
930986624 2:57596625-57596647 AAATGGCTAGGTTCCTAAGATGG - Intergenic
933491612 2:82992036-82992058 AAAAAAATATGTTCATAAGTTGG + Intergenic
934522132 2:95026111-95026133 GAAAAACTGGGTTCCCAACTGGG + Intronic
937568050 2:123320288-123320310 AAAAAATTAGGTATCTAATTAGG + Intergenic
939147423 2:138432755-138432777 AAAAAACTAGGTTCTGGAATTGG + Intergenic
940634411 2:156280489-156280511 AAAAAAATAGATGCCTAAGATGG + Intergenic
941523732 2:166581306-166581328 AATGAACCAGGTACCTAAGTTGG - Intergenic
943041477 2:182810462-182810484 CAAAAACTAGGTTCCTAACTAGG + Intergenic
943253092 2:185555469-185555491 AAAACACTAGATTACTAATTTGG + Intergenic
944825191 2:203475953-203475975 AAAAAAGTAGGTATGTAAGTAGG + Intronic
945883881 2:215354323-215354345 AAAAAATTAGTTTCCTGAGAAGG - Intergenic
945961697 2:216142065-216142087 AAAAAAAAAGGTTCCTAGGCTGG + Intronic
946917450 2:224539775-224539797 AAAAAAATAGGTATGTAAGTAGG + Intronic
1169402314 20:5293415-5293437 AAAAAACTATATTCCTTTGTGGG - Intergenic
1173049419 20:39545013-39545035 AACAAACCAGGGTCCTAACTTGG - Intergenic
1173140098 20:40474447-40474469 AAAAATCAATATTCCTAAGTGGG + Intergenic
1181232019 22:21426461-21426483 AAAAAACAAAGTTGCTATGTAGG - Intronic
1181246632 22:21508400-21508422 AAAAAACAAAGTTGCTATGTAGG + Intergenic
1181947308 22:26528218-26528240 AAATCACGAGCTTCCTAAGTGGG + Exonic
1185381472 22:50509899-50509921 AAAAAAGAAGATTCCCAAGTGGG - Intronic
949140909 3:631829-631851 AACAAACCAGGTTCCTATGTAGG + Intergenic
949748025 3:7317629-7317651 AAATAGCTAGGGTGCTAAGTAGG + Intronic
949846022 3:8371899-8371921 GATAAACTAGGTACCTCAGTTGG - Intergenic
951759595 3:26130510-26130532 GATGAACTAGGTTCCTCAGTTGG + Intergenic
952242676 3:31549242-31549264 AAAAAAGTATGTTCCTAATGTGG - Intronic
955175204 3:56606635-56606657 GATGAACTAGGTACCTAAGTTGG + Intronic
958172414 3:89954668-89954690 TAAAAAATAGGTTTTTAAGTTGG - Intergenic
959352034 3:105277926-105277948 AAAAAACTTGGTTTCCAAGGAGG - Intergenic
961101133 3:124200158-124200180 AGAAAACTGGGTTCCTAACCTGG + Intronic
961496492 3:127296080-127296102 AGAATCCTAGGTTCCTAAGCAGG + Intergenic
962414386 3:135168842-135168864 AAAAAATTAGGTTCAAAAGGAGG + Intronic
963544682 3:146641346-146641368 AAGAAACTGGGTTCTTAAGAGGG - Intergenic
965949180 3:174283504-174283526 AAATAACTAGGTTCATAAAATGG + Exonic
970429952 4:15979845-15979867 AAAAAACTATATTCCTAGATGGG - Intronic
973772056 4:54215794-54215816 AATAAACTAGGTTCATGGGTGGG + Intronic
973885508 4:55316768-55316790 AAAAAAAAAGGTTCATCAGTAGG + Intergenic
975830706 4:78365692-78365714 GAAAAAATACGCTCCTAAGTTGG + Intronic
976722266 4:88180290-88180312 AAAAAACTTGGATCCTAGGATGG + Intronic
979144663 4:117228708-117228730 AAAAAAGGATGTTCCAAAGTAGG - Intergenic
980037870 4:127905533-127905555 GAAGAACTAGGTACCTCAGTTGG + Intergenic
981464592 4:145053787-145053809 AAAAAAAAAGGTTCCTGACTAGG + Intronic
983023099 4:162703730-162703752 AAATAACTTGATTCCAAAGTGGG + Intergenic
983504904 4:168542515-168542537 AAAAGACTAGTTTCCTAGGTGGG - Intronic
985001312 4:185486691-185486713 AAAAAATTAGCTAACTAAGTTGG - Intergenic
985882256 5:2646917-2646939 GAATGACGAGGTTCCTAAGTTGG - Intergenic
988486588 5:31672629-31672651 AAAATACTAGACTCCAAAGTGGG - Intronic
988619744 5:32810977-32810999 CAAGAAATAGTTTCCTAAGTAGG - Intergenic
989050443 5:37314869-37314891 AGAAACCTAGGGTCCTCAGTAGG + Intronic
989061211 5:37413729-37413751 AAAAAAAAAGATTCCTATGTGGG + Intronic
989392529 5:40916425-40916447 AGAAACCAAGCTTCCTAAGTTGG - Intronic
990697340 5:58435123-58435145 AAAAAAGTAGTTTCTTAAGATGG - Intergenic
991270722 5:64776424-64776446 AAGAAATGAGGTTCTTAAGTTGG + Intronic
991984597 5:72271609-72271631 AAAAAACTATGTTCATAAAGAGG + Intronic
996559387 5:124812508-124812530 CAAAACCTAGGTGACTAAGTGGG + Intergenic
997495262 5:134318399-134318421 CAAAAAATAGGTCCCTAACTGGG + Intronic
999505102 5:152186322-152186344 AAGAAACTAGGGTCCAGAGTAGG + Intergenic
1000480782 5:161770990-161771012 AACAAACTACGTTACTAAGAAGG + Intergenic
1002178196 5:177414539-177414561 ACAGAACTAGGTGGCTAAGTAGG - Intronic
1002203979 5:177550160-177550182 AAAAAATTAAAATCCTAAGTGGG + Intronic
1003865079 6:10355502-10355524 AAAATACTAGGTTACTAACAGGG - Intergenic
1008114258 6:47529291-47529313 AAAAAAATTGGTTCCTAGCTGGG + Intronic
1010652800 6:78475040-78475062 GAAAAACTATGTTCCTAGGCCGG + Intergenic
1011304409 6:85910784-85910806 AAAAACCTGGGTTCCTCAGTTGG - Intergenic
1013635128 6:112021982-112022004 AAATAACAAGGTTTCTAAGTTGG - Intergenic
1014784478 6:125601996-125602018 AAAAATCTAGGATACTAAGTTGG + Intergenic
1015279128 6:131413878-131413900 AAAAAATTATTTTCCAAAGTTGG + Intergenic
1017331308 6:153200715-153200737 AAGAAACTAGGTTATTAAATAGG + Intergenic
1019063782 6:169277988-169278010 AAAAAACTAGTTACCTCAGGTGG - Intergenic
1021514207 7:21465148-21465170 AAATAACTAGGTACCAAAGAGGG + Intronic
1022902392 7:34824067-34824089 AAAAAATTAGGTTACAAGGTAGG + Intronic
1023085638 7:36567771-36567793 AAAAAAATTGCTTCCTCAGTAGG - Intronic
1026149738 7:67777759-67777781 AAGAAACAAGATTCCTGAGTTGG + Intergenic
1026349954 7:69507148-69507170 AAAGAACTGTATTCCTAAGTTGG + Intergenic
1031152353 7:118069047-118069069 AAAAATGGAGGTGCCTAAGTAGG - Intergenic
1031793321 7:126138105-126138127 AAAAAACCAGGTTGCTGAATGGG + Intergenic
1032110033 7:129068250-129068272 AAATAACTACCTTCCTAAGCTGG + Intergenic
1032731891 7:134651276-134651298 GAAAAACTAGGTTTTTAAGTTGG + Intronic
1037531993 8:19785747-19785769 AAAAAACTAAGGACCTAACTAGG - Intergenic
1039009069 8:33073519-33073541 GAAAAGGTAGGTTCCTAATTTGG - Intergenic
1039756604 8:40530146-40530168 AAACAGCTAGCTTCCCAAGTAGG + Intergenic
1040473947 8:47760477-47760499 GAAGAACTAGGTACCTCAGTTGG + Intergenic
1040728296 8:50410266-50410288 AAAAAACAATGTTCCTATCTAGG - Intronic
1041102399 8:54409561-54409583 AAAAAAAAAGATACCTAAGTGGG + Intergenic
1042609624 8:70583849-70583871 TAGAAATTAGATTCCTAAGTTGG + Intronic
1042786638 8:72554568-72554590 AAAGAACTAGGTTCAGAAGCAGG + Intronic
1043713770 8:83454894-83454916 AAAAAATTAAGTACCTAAGAAGG + Intergenic
1044771543 8:95640888-95640910 AGAAAACCAGCTTCCTAACTAGG - Intergenic
1044999895 8:97869692-97869714 AAAATACCAGGTTCCGAAGAGGG - Intronic
1045240567 8:100396993-100397015 AAAAAATTAAGTTATTAAGTTGG + Intronic
1045921091 8:107529913-107529935 ACAGAACAAAGTTCCTAAGTGGG - Intergenic
1048459168 8:134605724-134605746 AACAAACTAGTTCCCTATGTTGG - Intronic
1049126453 8:140793617-140793639 AAAGAACTAAGATGCTAAGTTGG + Intronic
1050834780 9:10062688-10062710 AAAATATTACTTTCCTAAGTAGG - Intronic
1051565444 9:18492111-18492133 AAAAAACTAAGTTACACAGTAGG + Intronic
1052371848 9:27674453-27674475 AAAAAACAAAATTCTTAAGTAGG - Intergenic
1052699757 9:31923179-31923201 AAAAACCTAGAGACCTAAGTAGG - Intergenic
1053875067 9:42536004-42536026 TAAAAACTAGGATCCTAAGTGGG - Intergenic
1054236630 9:62565715-62565737 TAAAAACTAGGATCCTAAGTGGG + Intergenic
1055042062 9:71885013-71885035 AAAAATCTATGAACCTAAGTGGG + Intronic
1056701404 9:88913881-88913903 AATATACTATGTTCATAAGTTGG + Intergenic
1058069435 9:100586657-100586679 AGAAAAATAGTTTCCTAGGTTGG + Exonic
1058175558 9:101732533-101732555 AAAAAACTAGGTTCCTAAGTAGG - Intronic
1058484901 9:105434037-105434059 AAAAAACTAGTTTGCTATTTAGG + Intronic
1060366298 9:123018282-123018304 TATAAAATAGGTTGCTAAGTTGG + Intronic
1187348680 X:18491343-18491365 AAAAAATAAGGCTCCTCAGTTGG - Intronic
1189486768 X:41439716-41439738 AAAAAACTAAGATCCTATATTGG + Intergenic
1191757336 X:64607517-64607539 AATAAACCAGGTACCTCAGTTGG + Intergenic
1195723991 X:107894802-107894824 AATAAACTAGGTTACAGAGTGGG + Intronic
1198163430 X:134030032-134030054 AAAAAGACAGGTTCTTAAGTTGG + Intergenic
1198325435 X:135566728-135566750 GAAAAACTAATTTCCTAATTGGG - Intronic
1198950719 X:142068257-142068279 AAGAAACTAGAATCCTAGGTTGG + Intergenic