ID: 1058175902

View in Genome Browser
Species Human (GRCh38)
Location 9:101737185-101737207
Sequence AACGGCTTGGTAAAGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058175902_1058175906 -2 Left 1058175902 9:101737185-101737207 CCCTCAGACTTTACCAAGCCGTT 0: 1
1: 0
2: 1
3: 3
4: 47
Right 1058175906 9:101737206-101737228 TTTTCTCTCCCCTCATGCAATGG 0: 1
1: 0
2: 1
3: 19
4: 241
1058175902_1058175907 4 Left 1058175902 9:101737185-101737207 CCCTCAGACTTTACCAAGCCGTT 0: 1
1: 0
2: 1
3: 3
4: 47
Right 1058175907 9:101737212-101737234 CTCCCCTCATGCAATGGCCCCGG 0: 1
1: 0
2: 2
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058175902 Original CRISPR AACGGCTTGGTAAAGTCTGA GGG (reversed) Intronic
907193536 1:52668214-52668236 AATAGCTGGGGAAAGTCTGAAGG + Intronic
908438008 1:64125762-64125784 GAGGGCTTGCTAAAGGCTGAAGG + Intronic
908878512 1:68704363-68704385 AAAGATTTGGGAAAGTCTGAGGG + Intergenic
913484561 1:119322069-119322091 AACGGCATAGTTCAGTCTGAAGG + Intergenic
916569196 1:166009983-166010005 AACAACTTGGAAAGGTCTGAGGG - Intergenic
1076879438 10:133232570-133232592 AACGGCTTGCCCAGGTCTGAGGG + Intergenic
1079341778 11:19617621-19617643 AAGTGCATGGTAAAGTGTGAGGG + Intronic
1084796392 11:71507625-71507647 AAGGGCTTGGTAAAAACTTAAGG + Intronic
1086301837 11:85434767-85434789 AACTGTTTGGAATAGTCTGAGGG - Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1093064536 12:14643020-14643042 AACGGATTTGTAAAGTATAAAGG - Intronic
1098688659 12:73458360-73458382 AACGAATTGAAAAAGTCTGATGG - Intergenic
1106703994 13:32261046-32261068 AGCAGCTGGGCAAAGTCTGATGG - Intronic
1107951181 13:45463832-45463854 ATTGTCTGGGTAAAGTCTGAAGG - Intergenic
1113309397 13:109116282-109116304 AAGGGCTTTGTAAGGTATGAGGG - Intronic
1127055513 15:55127071-55127093 GACATCTTGGCAAAGTCTGAAGG + Intergenic
1138173493 16:54874995-54875017 AACTGTCTGGTAAACTCTGAAGG + Intergenic
1143164740 17:4892253-4892275 AACGCCTGGGTGAGGTCTGAGGG + Intronic
1155460188 18:26071074-26071096 AAATGGTTGGAAAAGTCTGAAGG + Intronic
1156267839 18:35504339-35504361 TACTGCTTTGCAAAGTCTGAAGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
936560510 2:113535049-113535071 AAAAGATTGGTAAACTCTGATGG + Intergenic
944142042 2:196467347-196467369 AACTGCTTGGTATAGGATGAGGG + Intronic
944691897 2:202166069-202166091 AAGGGCTTGGCCAAGTGTGATGG + Intronic
1170077611 20:12436932-12436954 AAATGGTTGGTAAATTCTGATGG + Intergenic
1170711862 20:18798379-18798401 AAGGGCTTGATAAAGGCTGATGG + Intergenic
955271715 3:57506154-57506176 AACAACATGGTAAAGACTGAAGG + Intronic
959357627 3:105353129-105353151 AAAGGCCTGTTCAAGTCTGAGGG - Intergenic
959689138 3:109179681-109179703 AATGGCTTGGTAAAAACTCAAGG - Intergenic
971456779 4:26852592-26852614 GACTTCTTGGTAAATTCTGAAGG - Intergenic
977538880 4:98290628-98290650 AAAGGCTTGGCAAAGTTTGAAGG + Intronic
987435918 5:17894141-17894163 ATAGGCTTGGTACAGTCAGATGG - Intergenic
993320473 5:86463358-86463380 AAAGGCTTGTTAAACTCTGGAGG + Intergenic
998745542 5:145254838-145254860 TAGGTCTTGTTAAAGTCTGATGG + Intergenic
1005970708 6:30758951-30758973 AAATGCTTGGTATAGGCTGATGG + Intergenic
1011490582 6:87887149-87887171 AACCGCTTGGTAACCTCAGAAGG - Intergenic
1016327921 6:142923933-142923955 AACCGCTAGGTAAAGGCCGAGGG + Intronic
1023605273 7:41925520-41925542 AAAGGCTTGGTAAAGTGTGAGGG - Intergenic
1024104147 7:46064768-46064790 AAAGGCTTAGTGAAGTCTCATGG + Intergenic
1035915190 8:3611333-3611355 TAGGGCTTGGTGAAGCCTGAGGG + Intronic
1049892170 9:80296-80318 AAAAGATTGGTAAACTCTGATGG - Intergenic
1053733592 9:41081384-41081406 AAAAGATTGGTAAACTCTGATGG - Intergenic
1054694823 9:68350175-68350197 AAAAGATTGGTAAACTCTGATGG + Intronic
1055967452 9:81879541-81879563 AATGGCTTTGTAAACTATGAAGG - Intergenic
1057250491 9:93497304-93497326 AACGGCTTAGGAAAGTCTTAGGG + Intronic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1059906196 9:118989677-118989699 AAGGGCTGGGGAAGGTCTGATGG + Intergenic
1186242290 X:7582438-7582460 AAAGGATTTGCAAAGTCTGATGG + Intergenic
1188096176 X:26025918-26025940 AAAGGCTTGGTAATGTCATATGG - Intergenic
1189087266 X:38038723-38038745 AACTGATTAGTACAGTCTGAAGG - Intronic
1193582022 X:83277042-83277064 AGTGGCTTGGGAAAGTCTCAGGG - Intergenic
1195273309 X:103254343-103254365 GAGGGCCTGGGAAAGTCTGAAGG - Intronic