ID: 1058175906

View in Genome Browser
Species Human (GRCh38)
Location 9:101737206-101737228
Sequence TTTTCTCTCCCCTCATGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058175901_1058175906 -1 Left 1058175901 9:101737184-101737206 CCCCTCAGACTTTACCAAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 46
Right 1058175906 9:101737206-101737228 TTTTCTCTCCCCTCATGCAATGG 0: 1
1: 0
2: 1
3: 19
4: 241
1058175902_1058175906 -2 Left 1058175902 9:101737185-101737207 CCCTCAGACTTTACCAAGCCGTT 0: 1
1: 0
2: 1
3: 3
4: 47
Right 1058175906 9:101737206-101737228 TTTTCTCTCCCCTCATGCAATGG 0: 1
1: 0
2: 1
3: 19
4: 241
1058175903_1058175906 -3 Left 1058175903 9:101737186-101737208 CCTCAGACTTTACCAAGCCGTTT 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1058175906 9:101737206-101737228 TTTTCTCTCCCCTCATGCAATGG 0: 1
1: 0
2: 1
3: 19
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058175906 Original CRISPR TTTTCTCTCCCCTCATGCAA TGG Intronic
900925783 1:5705370-5705392 CTTACTCTCACCTCATGGAAGGG + Intergenic
901355621 1:8645433-8645455 AATCCTCTCACCTCATGCAATGG + Intronic
903989256 1:27254205-27254227 TCTTCTCTCCTCTCAAGAAAAGG - Intronic
906343449 1:45001084-45001106 CCTTCTCTCCCCTCAGGAAAGGG - Intergenic
907127064 1:52060070-52060092 TTTTCTCTCTGATGATGCAATGG + Intronic
908489775 1:64631935-64631957 GTTTCTCTCTTCTCATACAAAGG - Intronic
908704891 1:66942205-66942227 TTTTCAGTCCCCTGATGAAAAGG + Intronic
908737934 1:67295671-67295693 TTTTTTCCCCACTCATTCAAAGG - Intergenic
909267444 1:73578415-73578437 TTTTCTCTCCCAACTTGCCATGG - Intergenic
911903988 1:103542270-103542292 TTTTGTCTCCCCTCCTTAAAGGG - Intronic
912218682 1:107647167-107647189 TTATCACTGCCCTAATGCAATGG + Intronic
912406187 1:109439874-109439896 TTTTTTCACCCCTCATGCCTGGG - Intergenic
913610110 1:120502664-120502686 TATTCTCTCCAAGCATGCAATGG + Intergenic
913984687 1:143554179-143554201 TATTCTCTCCAAGCATGCAATGG - Intergenic
914581080 1:149019575-149019597 TATTCTCTCCAAGCATGCAATGG - Intronic
914922275 1:151855321-151855343 TTTCCCCTCACCTCCTGCAAAGG + Intergenic
915036990 1:152936085-152936107 TTTTATCTCCCGTCACTCAAAGG - Intergenic
915617942 1:157055618-157055640 TTTTTTCTCTTCTGATGCAAGGG + Intergenic
920234722 1:204494927-204494949 GTTTCTCTTCCCCCACGCAATGG - Intergenic
920762770 1:208801616-208801638 TTTTCTCTCCCATCCTACAGTGG + Intergenic
921621873 1:217334302-217334324 CTTCCTCTCCCCTCATACACTGG + Intergenic
1067686818 10:48470730-48470752 CTTTCTCTCCCCTTTTGGAAGGG + Intronic
1068982320 10:63074823-63074845 TTTTCTCTCCCAACTTCCAAGGG + Intergenic
1069154722 10:65013494-65013516 TTTTCTCTCCCCTAAGGAGATGG - Intergenic
1070112684 10:73500093-73500115 TCTTTTTTCCCCTCATGCACTGG - Intronic
1070636732 10:78134554-78134576 TTCTCTCTCCCTCCATCCAAGGG - Intergenic
1072002264 10:91208354-91208376 ATTTCTCTCCCCAGATGCCAAGG - Intronic
1073138811 10:101234421-101234443 CTTTTGCTCCCCTCATCCAAGGG + Intergenic
1073451082 10:103609736-103609758 TTATGTCCTCCCTCATGCAAAGG + Intronic
1074087352 10:110218534-110218556 TTTTCTCCCCACTCTTGCTAGGG + Intronic
1075162753 10:120039324-120039346 TTTTCTCTCTCCTCAAGCTCAGG - Intergenic
1077447762 11:2607276-2607298 CTTTTTCTCCCATCATGGAAGGG + Intronic
1078160340 11:8834659-8834681 TTTTCTTCCTCTTCATGCAATGG + Intronic
1078582361 11:12548299-12548321 TTTTTTCTCCCCTAATGGATTGG - Intergenic
1079022625 11:16922490-16922512 TTCTCTCTCCCCTCATTCCTGGG + Intronic
1079113031 11:17616852-17616874 TTTTCTCTCACCTATTGCACTGG + Intronic
1079769157 11:24437156-24437178 TTTTCTCTCTCCTCACTCAACGG + Intergenic
1080095703 11:28403829-28403851 TTTTCTTTTTCCTCATGCATGGG + Intergenic
1081533008 11:43977112-43977134 GTTTCTCCATCCTCATGCAAAGG + Intergenic
1082760260 11:57120540-57120562 TTTTCTCACCCCTTTTGGAAAGG + Intergenic
1083003057 11:59314592-59314614 TCTTCTCTCCCCACACCCAAAGG - Intergenic
1083381147 11:62269642-62269664 TTTTCTTTCCACTGATTCAAAGG - Intergenic
1085442137 11:76574992-76575014 TTACCTCTCCCCTCATACATTGG + Intergenic
1086834920 11:91608983-91609005 TTTACTCTCCCCTCTGGCTAGGG + Intergenic
1088456204 11:110035463-110035485 ATTCCTTTCGCCTCATGCAATGG + Intergenic
1088805095 11:113345295-113345317 TTTTATCTCCCCTCATCCTGCGG + Intronic
1089120575 11:116131685-116131707 TTATCACTCACCTCAAGCAAGGG + Intergenic
1090024500 11:123156148-123156170 CTCTCTCTCCCCTCACGCACAGG + Intronic
1091137972 11:133209812-133209834 TTTTCTCATACCTGATGCAAGGG - Intronic
1093788491 12:23219341-23219363 TTTTCACTCCCATCGTGTAAAGG - Intergenic
1094076533 12:26482122-26482144 TTATTTCTCCCTTCATACAACGG + Intronic
1094755047 12:33458517-33458539 TTTTCAATCCACTCATCCAATGG - Intergenic
1095650215 12:44598972-44598994 TTTTCTCCCCACTCAAGCATAGG - Intronic
1096188180 12:49597610-49597632 TTTTCTCTCTCCTCTGGCAAGGG - Intronic
1096424121 12:51486617-51486639 TTTTCTCTCCCCTCACCCTATGG - Intronic
1096837314 12:54359076-54359098 CTTTCCCTCCCCTCAAGGAATGG - Intergenic
1097338172 12:58407865-58407887 GCTTCTCTCCCCTCATAAAAAGG - Intergenic
1100066102 12:90647306-90647328 TTGTTTCTCCCCAAATGCAAAGG + Intergenic
1104630689 12:130399535-130399557 TTTTCTCTGCCCTGAAGCCATGG - Intronic
1105505825 13:21008856-21008878 TTTTATGTCTCCTCTTGCAAAGG - Intronic
1105987898 13:25587413-25587435 TTTTCTCTCTCCCCCTGCCATGG + Intronic
1106386721 13:29292893-29292915 GTTTCTCTCTCCTGATGCAATGG - Intronic
1106681855 13:32016614-32016636 TTCTCTATCCCTTCCTGCAATGG - Intergenic
1106802885 13:33274642-33274664 TTTTCTCTTCTATCATGTAAGGG - Intronic
1108904314 13:55450246-55450268 TTCTCTCTCCCATCCTGCACCGG + Intergenic
1109583642 13:64371415-64371437 TTCCCACTCCCCTCATGAAAGGG + Intergenic
1109740044 13:66541626-66541648 TTCTCTCTCCACTCTTCCAAGGG + Intronic
1109800459 13:67371062-67371084 GTCTCTCTCCCCTATTGCAATGG - Intergenic
1109986840 13:69997463-69997485 TTTTCTCTCCCTTCTAGCCACGG + Intronic
1110355661 13:74563889-74563911 TTTTCTCTCCTTAGATGCAATGG + Intergenic
1112683318 13:101792584-101792606 TTTTCACAGCCCTCTTGCAATGG - Intronic
1113204434 13:107898738-107898760 TTTCCTGTCACCTCATGCAATGG + Intergenic
1113650484 13:112030920-112030942 TTTTTTTTTCCCACATGCAAAGG - Intergenic
1114320583 14:21544039-21544061 TGTCCTCTCTCCTCATGCTATGG - Intergenic
1114599415 14:23942251-23942273 TTCTCTTTCCCCTCATGCCTAGG - Intergenic
1117107791 14:52416138-52416160 TTCTCTCTCCACTGATGCTATGG - Intergenic
1117562261 14:56952903-56952925 TTTTCCCTCCCCTCCTAGAAAGG + Intergenic
1117868694 14:60175522-60175544 TTTCCTCCTTCCTCATGCAAAGG + Intergenic
1118507558 14:66430259-66430281 TTCTCTCTGTCCTCCTGCAATGG - Intergenic
1122280357 14:100618586-100618608 TTTTCTCACCCCTCCCGCCAGGG - Intergenic
1128035637 15:64523292-64523314 GTTTCTCTCCAGTTATGCAAGGG - Intronic
1128255204 15:66191197-66191219 TTTGCTATCCCATCCTGCAATGG + Intronic
1130109281 15:80951152-80951174 TTTTCACTCTTCTAATGCAAGGG + Exonic
1131392299 15:92059321-92059343 TTCTCTCTGCCCTCAGGCAGGGG + Intronic
1133878604 16:9759630-9759652 TTTTCTCTTCCCTGATTCACAGG - Exonic
1135932615 16:26751430-26751452 TCTTCTCTAGCCTCATCCAAAGG + Intergenic
1136478922 16:30529485-30529507 TGCTCCCTTCCCTCATGCAAAGG + Intronic
1136852903 16:33627416-33627438 TTTTCACTCCCTTCAGGCCAAGG - Intergenic
1139917993 16:70439691-70439713 GTCTCTCTCCCCTCAGGCCAGGG - Intergenic
1203114500 16_KI270728v1_random:1475836-1475858 TTTTCACTCCCTTCAGGCCAAGG - Intergenic
1145970905 17:28955965-28955987 TATTCTCTCGTCTCCTGCAAAGG + Exonic
1146669399 17:34726469-34726491 GTTTCTGTCCCCTCAAACAAGGG - Intergenic
1149505968 17:57194186-57194208 TTTTTTTTCTCCTCATGAAAGGG - Intergenic
1150061501 17:62072718-62072740 TGTTCTCTCCCCCCAAGAAAAGG + Intergenic
1152049348 17:77959661-77959683 TTTTCTCTTCCCCCAAACAACGG - Intergenic
1153505805 18:5796622-5796644 TGTTCTCTAGCCTCATGCCATGG + Intergenic
1154486566 18:14876272-14876294 TTTCCTCTTCTCTCCTGCAAGGG + Intergenic
1155038958 18:22048838-22048860 CTATTTCTCCCCTCATGAAATGG - Intergenic
1155936815 18:31763106-31763128 CTTTCTTTCCTCTCTTGCAAAGG - Intergenic
1158235131 18:55303756-55303778 TTTTCCTTCCCCTCAGCCAAAGG - Intronic
1159365737 18:67464105-67464127 TTCTCTGTTGCCTCATGCAATGG + Intergenic
1159654836 18:71020537-71020559 TTTTCTTTCTAATCATGCAAAGG - Intergenic
1162744275 19:12790130-12790152 CATCCTCTCCCCTCAAGCAATGG - Intronic
1164850375 19:31478272-31478294 TTCTCTGTCCCCTCATGCCTGGG + Intergenic
1165610770 19:37150188-37150210 TCTTCCTTCCCCTCAGGCAATGG - Exonic
925258112 2:2507082-2507104 CTTTCTCTCCCAACAGGCAAGGG - Intergenic
926744398 2:16138982-16139004 TTCCCTCCCCCCTCATGCATAGG - Intergenic
928216304 2:29364287-29364309 TTCTCTGTCCCCTCCTGGAAGGG + Intronic
931161993 2:59702704-59702726 TTCTCTCTCCCCTCTTTCAGTGG + Intergenic
931522531 2:63114932-63114954 TTTCCTCTCCCCTCATCCCCTGG + Intergenic
931906180 2:66846254-66846276 TTATCTCTGCCTTCTTGCAAGGG + Intergenic
934086499 2:88514265-88514287 TTTTCTCACCACGCATGCAGAGG + Intergenic
935150884 2:100434351-100434373 TTTTCTCTCCAATCATGGAAGGG + Intergenic
937545979 2:123021482-123021504 TCATCTCTCCCCTTAAGCAAGGG + Intergenic
940976924 2:159956754-159956776 TTTTCTTTCACCTCCTCCAAAGG + Intronic
941601756 2:167551363-167551385 TTTTCTACCCCCTTATCCAAAGG - Intergenic
943813206 2:192216567-192216589 TTTATTCTGCTCTCATGCAATGG - Intergenic
948946723 2:241224220-241224242 TTTCCTCTTCCCTCAGGCAGCGG + Exonic
1169328565 20:4697914-4697936 TTTTCTCTCCCAGCATACATTGG - Intronic
1169772667 20:9218663-9218685 TCTTCCTTCCCCTCATGGAAAGG - Intronic
1173342540 20:42165374-42165396 TTTCTTCTCCCCTCCTTCAAGGG - Intronic
1175137777 20:56837947-56837969 TTCTGTCTCCCATCCTGCAAGGG - Intergenic
1176794735 21:13363103-13363125 TTTCCTCTTCTCTCCTGCAAGGG - Intergenic
1176986743 21:15445994-15446016 TTTTCTCTCCCTAAATGAAATGG + Intergenic
1178117395 21:29431494-29431516 TTTTCTCTCCCCTTTTCCCACGG + Intronic
1184635909 22:45831182-45831204 TCTTCTCTCCCCTCAACCACTGG - Intronic
1184833046 22:47002725-47002747 TTCCCACTCCCCTCATCCAACGG - Intronic
1184957201 22:47897236-47897258 TTTTCCTTCCACTCATGGAATGG - Intergenic
949484904 3:4528570-4528592 TTTTAAATACCCTCATGCAAAGG + Intronic
949931101 3:9079104-9079126 TGTTCTTTCCCCTCATACCAGGG + Intronic
953141308 3:40231740-40231762 CTTTCCCTTCCCTCATGCTATGG + Intronic
954073258 3:48158610-48158632 TCTCCTCTCCCCTCATGAGATGG + Exonic
955525576 3:59816426-59816448 TTTTATCTCCAATCATGCCAAGG - Intronic
956273265 3:67470396-67470418 TTTTCTCTACAATGATGCAATGG + Intronic
958425649 3:93975917-93975939 TGTTCTCTCTTCTCTTGCAATGG - Intergenic
959529334 3:107414503-107414525 TTTTCCCTCCCCTCAGTCACAGG - Intergenic
959942911 3:112098095-112098117 TTTTCTCTCCCTTCTTTCACTGG + Intronic
960664051 3:120093701-120093723 TTTTCTCTCCTCCCAGGAAAGGG - Intronic
963527072 3:146428653-146428675 TTTTTACTCCCCTCAGACAATGG + Intronic
964032597 3:152154370-152154392 TTTTCTGTCTCCTCAGGCATGGG - Intergenic
964340380 3:155702868-155702890 TTTTCTCTAGCCTCAGCCAAGGG - Intronic
964652299 3:159025985-159026007 CTTTCTCTTGCCTCAGGCAATGG + Intronic
966830494 3:184003923-184003945 TGTTCTCTCCCCTCACTCAATGG - Intronic
966986389 3:185184158-185184180 TTCTCTCTCCTCTCTTTCAATGG - Intergenic
967310418 3:188100880-188100902 TTTTATTTCCCCTCATAAAAAGG + Intergenic
969941001 4:10731403-10731425 ATTCCTCTCCTCTCATGCAGGGG + Intergenic
971904086 4:32703642-32703664 TTTTCTCTCACCTCACCCAGGGG - Intergenic
972397875 4:38672855-38672877 TTTGCTCTCCCCTCCTGCCTTGG - Intronic
972422885 4:38906148-38906170 TTCTCTCTCCCCTCAACCAGAGG - Intronic
972864988 4:43220828-43220850 TTTTCTCTCACCTTTTGCTATGG - Intergenic
975721594 4:77253802-77253824 TTTTCACCCCCCTCATTAAAGGG - Intronic
976370259 4:84279599-84279621 TTTTCTCTCTCTTCTTGCAGAGG - Intergenic
977664714 4:99632682-99632704 TTTACTCTCCCCTCATGCCCTGG + Intergenic
977683233 4:99817801-99817823 TTTTGCCTCTCCTCATGCACAGG - Intronic
981752186 4:148103158-148103180 TTTTCCCTTGCCTCATGCCATGG + Intronic
982088140 4:151857193-151857215 TCCTCCCTCCCCTCATGCTATGG + Intergenic
983058652 4:163129348-163129370 TTTTCCCTCCCCTCACTCAAAGG - Exonic
983565907 4:169151558-169151580 CTTTCTCTCACCTCATCTAAGGG - Intronic
983624824 4:169791808-169791830 TTCTCGCTCCCCTCAGGCGACGG + Intergenic
984230687 4:177094838-177094860 TTTTTTCTCCTCTGATGCCAGGG + Intergenic
985888326 5:2697224-2697246 TTCTCTCTGCCCCCATGCAGTGG - Intergenic
986684663 5:10266005-10266027 TTTTCTCTACATTCATGCATTGG + Exonic
986826137 5:11524830-11524852 TTTTGTTTCTCATCATGCAAAGG + Intronic
986977054 5:13407355-13407377 TTTTTTCTCCCCTCGTGGAAAGG - Intergenic
987163926 5:15174109-15174131 TTTCCTCTCCCCTCCTCAAATGG - Intergenic
988773989 5:34459840-34459862 TTTTCTCTCCCCTCTTTAAAAGG - Intergenic
989800587 5:45533776-45533798 TTTTCTCACCTCTCAGGAAAGGG + Intronic
990055218 5:51567624-51567646 TTTTCTCTCTGCTCAAGAAAAGG - Intergenic
990128947 5:52555804-52555826 CTTTTTCTTCCCTCATGAAATGG - Intergenic
991380637 5:66020622-66020644 TTTTCTCTCTCCTTTTACAAAGG - Intronic
992089934 5:73307723-73307745 TTCTCTCTCTCTTCAGGCAATGG + Intergenic
992153778 5:73933704-73933726 TTTTCTCTCTTCTCTTGCATTGG + Intronic
992466950 5:77015571-77015593 GTCTCTCTCCCCTATTGCAATGG + Intergenic
993050727 5:82923055-82923077 TTCTTCCTCCCCACATGCAAGGG - Intergenic
993792132 5:92221845-92221867 TTTTCTATCAGCTCCTGCAATGG + Intergenic
994082599 5:95724259-95724281 TTTTCAGTCCCATTATGCAAAGG + Intronic
994713135 5:103290478-103290500 ATGTCTTTCCCCTGATGCAAAGG - Intergenic
996496735 5:124166046-124166068 TTTCCTCACCCCTCATGCAGAGG + Intergenic
997280343 5:132639658-132639680 TGTTCTCTCCCCTCACACCAAGG - Intronic
997375756 5:133396080-133396102 TCTTCTCTCCCCTCATTCACAGG + Intronic
998066597 5:139164307-139164329 TTTTCTCTTCCCTCTTGTGAGGG - Intronic
998555822 5:143122766-143122788 TTATCTCTCCCCTCATTTATTGG + Intronic
998800953 5:145868462-145868484 TTTTCTCTCCCTTTCTTCAAGGG + Intronic
999772278 5:154784642-154784664 TTTTCTCACCTTTCATGCACAGG + Intronic
999989160 5:157033751-157033773 TTTTCTCTCCCCTAAGAAAAGGG + Intronic
1000078346 5:157817652-157817674 TTTTCTCTCCCATCCTGTAGAGG - Intronic
1000274087 5:159717221-159717243 TTTTCTCTGCCCCCATACACAGG - Intergenic
1000754542 5:165141244-165141266 ATTTCTCTGCATTCATGCAACGG - Intergenic
1000910377 5:167014538-167014560 TCTTATCTCTCCTCATGCAGAGG - Intergenic
1002676725 5:180921481-180921503 TTTTCCCTCCCCTCATTCCCTGG - Intronic
1002874604 6:1200248-1200270 TTTTCTCTCACCACATGCAGTGG + Intergenic
1002987723 6:2206988-2207010 TTTTCTCTGACCTCATGGCATGG - Intronic
1003007235 6:2393153-2393175 TGTTCTGTCCCCTGATGCAGGGG - Intergenic
1003743803 6:8976290-8976312 TTTTCTCGCCCCACAACCAAAGG - Intergenic
1003891193 6:10565230-10565252 TTTTCTCTGGCCTCCTGCAAGGG - Intronic
1010014547 6:71089406-71089428 TTTTCTTTCCATTCATGTAAAGG + Intergenic
1011937648 6:92800953-92800975 TTTTCTTTCCCTTCATATAAGGG + Intergenic
1012487487 6:99738287-99738309 TTTTTTCTGCCTTGATGCAATGG - Intergenic
1012733866 6:102914433-102914455 TTTTTCATCCCCTCATGCTATGG + Intergenic
1013045115 6:106477937-106477959 TTTTCTCTGCCCTGTGGCAATGG - Intergenic
1013634134 6:112012460-112012482 TTGTCTCTACCCTAATGCACAGG + Intergenic
1015118868 6:129679736-129679758 ATTTCTCTTCCCTCCTGCATTGG + Intronic
1015160351 6:130146330-130146352 TTTTCTCCTCCCTCATCCTAAGG - Intronic
1016976719 6:149815937-149815959 TTTTCTCTCCCAGCAAGCAAAGG - Intergenic
1017321297 6:153097214-153097236 TTTTCTCTCCTTTAATTCAATGG + Intronic
1017450298 6:154548661-154548683 TTTTCTCTCCCTACCTGCTATGG + Intergenic
1018500267 6:164402025-164402047 TTTTCTCTCTCCTCACTCACTGG + Intergenic
1018687377 6:166314291-166314313 TTTTTTCTCCCCTCAATCACCGG - Intergenic
1019335612 7:481180-481202 CTTCCTCTCCCCTCAGGCCATGG + Intergenic
1019668277 7:2263651-2263673 TCTCCCCTCCCCTCAGGCAAAGG + Intronic
1020401051 7:7777950-7777972 TTTGCTCTCCCCTTATTAAAAGG + Intronic
1023909746 7:44545102-44545124 CTTTTTCTTCCCTCATGAAAGGG + Intergenic
1026436204 7:70401170-70401192 TTACCTCTCCCTTCATGCCATGG - Intronic
1027390992 7:77703333-77703355 TTATCTCTCCCATTATGCTAAGG + Intronic
1029946931 7:104542682-104542704 TTTTCTCTCCCCCCATGCACTGG - Intronic
1030610275 7:111681223-111681245 TTTTCTCACCCATTTTGCAAGGG - Intergenic
1032181009 7:129677959-129677981 TTTTACCTCCCCAGATGCAATGG + Intronic
1033383046 7:140842702-140842724 TTTTTTCTACCATCATCCAAAGG - Intronic
1033470309 7:141641226-141641248 TTTTCTCTCTCCACATTAAAAGG + Exonic
1033711565 7:143951407-143951429 TTTTCTATCCACACTTGCAATGG + Intergenic
1034707427 7:153158127-153158149 TTTTCTCTCCCCTGCAGAAACGG - Intergenic
1035779931 8:2220232-2220254 TTTTCTCTCCTCTTCTGCTACGG + Intergenic
1036442949 8:8797489-8797511 TTTTCTCTCTCCTCCTACAGGGG - Exonic
1037402602 8:18507937-18507959 TTGTATCACCCCTCAAGCAATGG - Intergenic
1038337357 8:26656054-26656076 TCTTCCCTCCCCCCATGAAAAGG - Exonic
1039784512 8:40821559-40821581 TTTTCTGTCCTCTCGTGCAAAGG + Intronic
1040424082 8:47266898-47266920 TTCTCTCTTCCCTCATCCATTGG + Intronic
1040740483 8:50569008-50569030 TTTTCTCTTACCTGATACAAGGG - Intronic
1044860425 8:96518011-96518033 TTTTCTCTCCCTCCCTGAAATGG + Intronic
1045492577 8:102681460-102681482 TTTTCTCTGCCCCAATGCCATGG + Intergenic
1045717096 8:105060034-105060056 TTTCCTTTCCCCCCATGCATAGG - Intronic
1046145740 8:110156162-110156184 TTTTCTCTCCTCAGATCCAAAGG + Intergenic
1048229083 8:132619647-132619669 TTTTCTCTGCCCCCATTTAATGG - Intronic
1052063510 9:23988804-23988826 CTTTCTCTCCCGGCATGTAAAGG - Intergenic
1055074616 9:72200653-72200675 CTTTCTCTCCCGTCATAAAACGG - Intronic
1058175906 9:101737206-101737228 TTTTCTCTCCCCTCATGCAATGG + Intronic
1059503876 9:114780383-114780405 TTTATTCTGCTCTCATGCAATGG + Intergenic
1060011896 9:120050995-120051017 TTTTCTTTCCACTCAGGAAACGG + Intergenic
1060928559 9:127473178-127473200 TCTTCTTTCCCCTCATGGGAAGG - Intronic
1062015140 9:134287596-134287618 TTTTCTCCCTCCTGCTGCAACGG + Intergenic
1185836718 X:3351462-3351484 TTTTCCCTCCAGTCATCCAAGGG - Intergenic
1186098903 X:6133828-6133850 TTTTCTGACCCCTGATGTAAAGG - Intronic
1186622999 X:11261209-11261231 TATTTTCTCCCCTCATGTACTGG - Intronic
1188544426 X:31288076-31288098 TTTTCTCTCCCTTCAACCAAGGG - Intronic
1188578445 X:31681381-31681403 TTTTCCCTCCCCTCATCCCTTGG - Intronic
1188932632 X:36131837-36131859 TTCTCTCTTCCCTCATACCATGG - Intronic
1190597453 X:52063101-52063123 TTTACTTTCCTCTCATGCCAAGG - Exonic
1190611371 X:52190972-52190994 TTTACTTTCCTCTCATGCCAAGG + Exonic
1191646639 X:63488540-63488562 TTCCCTCTCCCCTCAAGCAGAGG - Intergenic
1191986311 X:66985250-66985272 TTTTCTCTTCCAACATGCAGAGG + Intergenic
1192762158 X:74104870-74104892 TTCTCTGTTCCCTCAGGCAATGG - Intergenic
1194224052 X:91232897-91232919 TTTTCTCTCTCCTGATTGAATGG + Intergenic
1196463018 X:115948786-115948808 TTATCTCTCCCCTCAAAGAAAGG + Intergenic
1196495136 X:116316255-116316277 TTTTGTCTAAGCTCATGCAAAGG + Intergenic
1196739878 X:119015467-119015489 TTCTTTCCCCCCCCATGCAAAGG + Intronic
1197887403 X:131233057-131233079 TTTTCTCTCCCATCAAGGAGTGG + Intergenic
1199339458 X:146659899-146659921 TTTTAGCTCCCATCATACAATGG + Intergenic
1199440709 X:147864949-147864971 TTTTCTCCCCCGTAAGGCAATGG - Intergenic
1200345111 X:155440099-155440121 TTTCCCCTCACCTCCTGCAAAGG + Intergenic
1200560517 Y:4696277-4696299 TTTTCTCTCCCCTGATTGAATGG + Intergenic
1201239907 Y:11948595-11948617 TTTTCCCTCCAGTCATCCAAGGG + Intergenic
1202071873 Y:21000376-21000398 CTTACTCTCCCCTCCTGCCAGGG - Intergenic