ID: 1058175907

View in Genome Browser
Species Human (GRCh38)
Location 9:101737212-101737234
Sequence CTCCCCTCATGCAATGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058175902_1058175907 4 Left 1058175902 9:101737185-101737207 CCCTCAGACTTTACCAAGCCGTT 0: 1
1: 0
2: 1
3: 3
4: 47
Right 1058175907 9:101737212-101737234 CTCCCCTCATGCAATGGCCCCGG 0: 1
1: 0
2: 2
3: 14
4: 144
1058175903_1058175907 3 Left 1058175903 9:101737186-101737208 CCTCAGACTTTACCAAGCCGTTT 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1058175907 9:101737212-101737234 CTCCCCTCATGCAATGGCCCCGG 0: 1
1: 0
2: 2
3: 14
4: 144
1058175901_1058175907 5 Left 1058175901 9:101737184-101737206 CCCCTCAGACTTTACCAAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 46
Right 1058175907 9:101737212-101737234 CTCCCCTCATGCAATGGCCCCGG 0: 1
1: 0
2: 2
3: 14
4: 144
1058175904_1058175907 -9 Left 1058175904 9:101737198-101737220 CCAAGCCGTTTTCTCTCCCCTCA 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1058175907 9:101737212-101737234 CTCCCCTCATGCAATGGCCCCGG 0: 1
1: 0
2: 2
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058175907 Original CRISPR CTCCCCTCATGCAATGGCCC CGG Intronic
901394944 1:8974337-8974359 ATCCCCTCAGGCAAGGGCCACGG + Exonic
901563917 1:10096388-10096410 CTCCCCTCAAGCAGTGGCCTCGG + Intronic
904190157 1:28737168-28737190 CTCGCCTCACACAATGGCCGAGG - Intronic
905960082 1:42035885-42035907 CTCCTCGCATGCCGTGGCCCGGG - Intronic
906062318 1:42957297-42957319 CTCACCTCAAGCGAGGGCCCAGG + Intronic
906343448 1:45001078-45001100 CTCCCCTCAGGAAAGGGCCCAGG - Intergenic
906777639 1:48544040-48544062 CTCCCATCAGGCACTGGCCTGGG - Intronic
908425879 1:64006723-64006745 CTCCCCACCTACAGTGGCCCTGG - Intronic
919522105 1:198601057-198601079 ATCCTCTGAAGCAATGGCCCTGG + Intergenic
920677955 1:208051370-208051392 CCCCCATCATCCAATGGCCTTGG - Exonic
1062878253 10:959031-959053 GTCCCCACAGGCAACGGCCCTGG + Intergenic
1065120572 10:22526137-22526159 CTTCCCTCATGCTCTGTCCCAGG + Intergenic
1066509799 10:36083467-36083489 CTCCCCGCAGGCACTGTCCCAGG + Intergenic
1067431791 10:46250194-46250216 CTCAGCTCTGGCAATGGCCCTGG - Intergenic
1067683478 10:48454306-48454328 CTCCCCTCAAGGAGTGGCCAGGG + Intronic
1067691344 10:48504200-48504222 CTCCAGTCATCCAATGGCCAAGG + Intronic
1070140701 10:73735038-73735060 CACCCCTCCTGCCAAGGCCCTGG - Intergenic
1074607769 10:114991042-114991064 CCCCTCTCATTCCATGGCCCTGG - Intergenic
1076675672 10:132146389-132146411 CACCCCTCTTGGGATGGCCCTGG - Intronic
1077002842 11:333287-333309 CCACCCTCATGCAGAGGCCCAGG - Intergenic
1078151025 11:8759792-8759814 CTCTCCTCATCCATGGGCCCTGG + Intronic
1081962402 11:47148117-47148139 CAACCCTCAGGAAATGGCCCAGG + Intronic
1083269529 11:61564817-61564839 CTTCCCCCATCCACTGGCCCAGG + Intronic
1083761024 11:64817871-64817893 CACCCCTCCTGCGATGGGCCTGG - Intergenic
1084480304 11:69416078-69416100 CCTCCCCCATGCTATGGCCCTGG + Intergenic
1088682301 11:112253753-112253775 CTCCCTCCATGCACTGGGCCTGG - Intronic
1090419621 11:126565294-126565316 CTCTCCTCAAGCAGTTGCCCTGG - Intronic
1092181171 12:6447970-6447992 CTCCCCTCCTGCACTGTCCCAGG + Intronic
1093013232 12:14130029-14130051 CCTTCCTCATGCAGTGGCCCAGG - Intergenic
1094030861 12:26010089-26010111 CCCCCCACGTGCCATGGCCCAGG + Intronic
1098268463 12:68746818-68746840 CCCACCTCCTGCACTGGCCCCGG + Intronic
1101444127 12:104725171-104725193 CCCTCCTCATGCAATGGCAGAGG + Intronic
1102575165 12:113851529-113851551 CTCCCCTCAGGCACAGGCCTGGG + Intronic
1103169393 12:118801464-118801486 CTTTCCTCATTCAATGGCCTTGG + Intergenic
1106239958 13:27903672-27903694 CTGCACTAATGCAGTGGCCCAGG + Intergenic
1107379063 13:39836181-39836203 CTCACCTTATGCAGAGGCCCTGG - Intergenic
1108347412 13:49559932-49559954 CTCACATCATTCAATGGCTCTGG - Exonic
1110418781 13:75280988-75281010 CTCCACACAGGCAGTGGCCCTGG + Intergenic
1118376304 14:65180289-65180311 CTCCCTTCCTAAAATGGCCCAGG + Intergenic
1119472823 14:74909998-74910020 CTTCCCTCAGGCCATGCCCCTGG - Exonic
1121682895 14:95808914-95808936 CTCCCCACAGCAAATGGCCCTGG - Intergenic
1122417074 14:101555089-101555111 CTCCACTCAAGCACTGGTCCTGG - Intergenic
1125549820 15:40537045-40537067 CTCCACTCATGCTCTGGGCCAGG - Intronic
1125591226 15:40855782-40855804 CTCCCCACCTGCCATGGCTCAGG - Intronic
1125986354 15:44056863-44056885 CCTCCCTCCTGCAATGTCCCTGG - Intronic
1126211206 15:46103155-46103177 CTCCACCCATGCAATATCCCTGG + Intergenic
1128426297 15:67544946-67544968 TTCCCCTCATGATAAGGCCCAGG + Intronic
1128498479 15:68211258-68211280 CTCACCACATGCAGTGACCCAGG + Exonic
1133773701 16:8882518-8882540 CTCCCCTCATTCAGGGGCCAGGG + Intergenic
1134891580 16:17845960-17845982 CTCACCTCATGCACTGTCACAGG + Intergenic
1135846905 16:25927167-25927189 TTCCTCACAGGCAATGGCCCAGG + Intronic
1141907222 16:87035020-87035042 ATCCCCTCATGCTATGGCATCGG + Intergenic
1142669793 17:1482817-1482839 CTCCCCTCCCGCACTGGCACTGG + Intronic
1143108390 17:4540727-4540749 CTCCCCTCCAGCAGTGGCCCGGG + Intronic
1143260068 17:5592123-5592145 CTTCCCCCATGTAATGGCCAAGG - Intronic
1144576307 17:16431949-16431971 CTCCCTTCATCCCATAGCCCTGG + Exonic
1145978683 17:28998758-28998780 CACCCATCATGGATTGGCCCAGG + Intronic
1146932863 17:36790520-36790542 CTCTCCTCAAGCACAGGCCCTGG - Intergenic
1147575327 17:41595641-41595663 CTCCCCTCAGCCTATGGCACAGG - Intergenic
1148577688 17:48723117-48723139 CTCCCCCCAGGCACTGGCCTGGG - Intergenic
1148991838 17:51672912-51672934 CTCCCCTCCTGCAAAGCCACTGG - Intronic
1159891692 18:73959059-73959081 TTCACCTCAGGCAATAGCCCAGG + Intergenic
1160426073 18:78780117-78780139 CGCCACTCCTGCAATGGCCAAGG + Intergenic
1160764703 19:802292-802314 CTCCACTCCTGCCCTGGCCCTGG - Intronic
1161220256 19:3115079-3115101 CTCCCCGCCTGCTGTGGCCCGGG - Intronic
1161321092 19:3641887-3641909 CTCCCCTCTGGGACTGGCCCTGG - Intronic
1161431302 19:4233771-4233793 CACCGCCCATGCAAAGGCCCTGG - Intronic
1163848306 19:19649860-19649882 CTCCCCAAAGGCACTGGCCCTGG - Exonic
1165214606 19:34261615-34261637 CTCCCCTCTTGCTGTGGCACTGG - Intronic
1166350899 19:42197617-42197639 CACCCCTCATGTAAGGGCTCAGG - Intergenic
1168520872 19:57049697-57049719 CTCGCCTCGTTCACTGGCCCAGG + Intergenic
926272101 2:11374600-11374622 CTCCCCTCATCCAGCGGCCGTGG + Intergenic
926906629 2:17811757-17811779 CCCTCCTCAAGCAGTGGCCCTGG - Intergenic
927424589 2:22968068-22968090 CACCACTCATGCAATTGCACAGG - Intergenic
929579004 2:43070063-43070085 CTCCTTTCATTCACTGGCCCTGG - Intergenic
930538483 2:52673887-52673909 CTCCCAGCATGCAATGGATCTGG + Intergenic
932322364 2:70831636-70831658 CTCCCTTCATGCCCTGGCCATGG + Intronic
934152458 2:89160475-89160497 CACCCCTCATGGAAGGGGCCGGG - Intergenic
934214789 2:90021439-90021461 CACCCCTCATGGAAGGGGCCGGG + Intergenic
936080757 2:109430940-109430962 CTGCCCTCATTCAATGACCTTGG - Intronic
937403696 2:121608356-121608378 GTCCCCTCCTGCAATGACTCTGG + Intronic
939272162 2:139954011-139954033 CTCATCTCATGGAATGGCCAAGG + Intergenic
1169771699 20:9208178-9208200 CACCCCTGATGCACTGGCCCTGG - Intronic
1170517848 20:17150104-17150126 TTCCCCTCATGCAATGGACATGG - Intergenic
1179912734 21:44459043-44459065 CTCCACTCATACACTGGGCCTGG - Exonic
1179913927 21:44464412-44464434 GTCCCCTCCTGCCCTGGCCCTGG + Intergenic
1179934403 21:44592961-44592983 CCCCCACCATGCCATGGCCCAGG - Intronic
1181622071 22:24098084-24098106 CTCCCCTCCTCCTCTGGCCCAGG + Exonic
1183167285 22:36157209-36157231 CTCCCCCACGGCAATGGCCCAGG + Intronic
1184359582 22:44006954-44006976 CTCCCCTCCTGCACTTGCCCAGG - Intronic
1184677811 22:46053213-46053235 CTCCTCCCATGCCAGGGCCCAGG - Intronic
1184826030 22:46951866-46951888 CTCCCCTCATGCAGAGCCTCTGG - Intronic
950338985 3:12224810-12224832 CTCCACACAGGCAGTGGCCCCGG - Intergenic
950671893 3:14532272-14532294 CTCCCCTCATGAAAAAGACCTGG - Intronic
950731697 3:14965108-14965130 CTCCCCACAGACAGTGGCCCCGG + Intronic
955003157 3:54945764-54945786 TTCCCAACATACAATGGCCCAGG - Intronic
955134241 3:56200146-56200168 CTCACCTAATGTACTGGCCCTGG - Intronic
955387135 3:58488927-58488949 CTCCCCTCATGAGATGGCTGGGG - Intergenic
961659828 3:128462849-128462871 CCCCCCTCAGGCCATGGCCCCGG + Exonic
962830697 3:139136629-139136651 CCTCCCTAATGAAATGGCCCAGG - Intronic
963088658 3:141461990-141462012 CACACCTAATGCAGTGGCCCTGG + Intergenic
964204871 3:154162556-154162578 CTCCACACATGCAATGGCCCTGG - Intronic
965212166 3:165805804-165805826 CTTAACTCATGAAATGGCCCTGG + Intronic
966826470 3:183969170-183969192 CTTCCCTAAAGCAAAGGCCCAGG + Intronic
968546094 4:1199779-1199801 CTCCTCTCCTGCCCTGGCCCCGG - Intronic
968914604 4:3491982-3492004 CTCCCCTCCTGCCCTGCCCCAGG + Intronic
969188453 4:5497564-5497586 AACCCTTCATGCAAAGGCCCAGG - Intronic
969307800 4:6335711-6335733 CTCCCTGCATGCAGTGGCCTGGG - Intronic
969558298 4:7928805-7928827 CTGCCCTCCTGCAATGGCCGCGG + Intronic
977957961 4:103052339-103052361 CTCACCTCCTGCCACGGCCCGGG + Intronic
980154389 4:129087064-129087086 CTCCCCCCGTGTCATGGCCCTGG - Intronic
981356712 4:143797989-143798011 ATGCCCTTTTGCAATGGCCCAGG + Intergenic
981378034 4:144038859-144038881 ATGCCCTTTTGCAATGGCCCAGG + Intergenic
986710127 5:10482609-10482631 CTGCCCTCATGCCAGAGCCCTGG - Intergenic
991248464 5:64533088-64533110 CTTCCCTCTTGCTATGGCCCAGG + Intronic
991957084 5:72005771-72005793 CTCCCTTCATGTAATGACTCAGG - Intergenic
993846745 5:92953615-92953637 CTTCTCTCATGCTTTGGCCCTGG + Intergenic
996192662 5:120564478-120564500 CTCCCTACATGCAAGGGCGCTGG + Intronic
997929182 5:138058374-138058396 CTCCACACAGACAATGGCCCTGG + Intergenic
998069393 5:139185068-139185090 CTCCACACAAGCAGTGGCCCTGG - Intronic
1000312947 5:160062624-160062646 CTCCATCCATGTAATGGCCCTGG + Intronic
1001099014 5:168798610-168798632 CCCTCATCATGCAATGGCCTTGG - Intronic
1002454277 5:179337495-179337517 CTCCCGCCATGCACAGGCCCAGG + Intronic
1002563474 5:180097662-180097684 CTCCCCTCCTGCACCTGCCCCGG - Intergenic
1003528847 6:6920818-6920840 AGCTCCTCATGCACTGGCCCAGG - Intergenic
1005170995 6:22984442-22984464 CCCCCATCCCGCAATGGCCCTGG - Intergenic
1005728662 6:28674363-28674385 CTCCCCACATGCAATGGCTCGGG + Intergenic
1006838515 6:37013801-37013823 CTCCCAGCATGCAGTGGCTCAGG + Intronic
1007739942 6:44004144-44004166 CTCCCCACTTGCAGTGGCCGTGG + Exonic
1013274302 6:108569649-108569671 CTCACCCCAGGCAATGACCCAGG - Intronic
1015883777 6:137895535-137895557 CTGCCCTCTTGTAATGCCCCAGG - Intergenic
1019034571 6:169043450-169043472 CTCTCCTCATCAACTGGCCCTGG - Intergenic
1022507191 7:30914577-30914599 CTCCCGTCAGACACTGGCCCTGG + Intronic
1023358032 7:39387029-39387051 GTCCCCTGCTGCAATGGCCCTGG - Intronic
1024988037 7:55212931-55212953 CTCTCCTGATGGGATGGCCCTGG + Intronic
1025227899 7:57179864-57179886 CTCACCTCCTGCAGTGGCCGCGG + Intergenic
1026481616 7:70784601-70784623 CTCCCCTCCTCCCATGACCCAGG + Intronic
1033474192 7:141674893-141674915 CTCCACTGTTGAAATGGCCCAGG - Intronic
1035600129 8:892468-892490 CTCCACTCATACAATGCCCCTGG + Intergenic
1036903364 8:12688272-12688294 CTCCCCTCCTCCCCTGGCCCCGG - Intergenic
1037281017 8:17242172-17242194 CTCCACTCAGGTAGTGGCCCGGG + Intronic
1037933270 8:22897233-22897255 CTCCTATCATGCAAAGTCCCTGG + Intronic
1049216362 8:141410122-141410144 ACCCCCTCATGCCATGGCCTGGG + Intronic
1049599228 8:143499313-143499335 CTCCCACCATGCTCTGGCCCTGG - Intronic
1056100758 9:83298583-83298605 CTGTGCTCATGCCATGGCCCAGG + Intronic
1057011430 9:91605824-91605846 AACCCCTGATGCAAAGGCCCAGG + Intronic
1057181747 9:93034441-93034463 CTCCCCCCAAGCAGTGGCCCTGG + Intronic
1057216295 9:93230647-93230669 CTCCCCTCATGCCAAGGACCTGG - Intronic
1058175907 9:101737212-101737234 CTCCCCTCATGCAATGGCCCCGG + Intronic
1058439247 9:104991961-104991983 ATCGCTTCATGCACTGGCCCAGG - Intergenic
1059170180 9:112117293-112117315 CTCCCCTCATGGAGTGCCCACGG + Intronic
1061039486 9:128131676-128131698 CTCCCCTTGTGCCATGGCTCAGG - Intergenic
1061115588 9:128609025-128609047 ATCCCCTCATACGAAGGCCCAGG + Intronic
1062303615 9:135889636-135889658 CTGCGCTCATGAGATGGCCCAGG - Intronic
1062599403 9:137313185-137313207 TTCCCCACATGCTGTGGCCCTGG - Intronic
1186622997 X:11261203-11261225 CTCCCCTCATGTACTGGCATGGG - Intronic
1187496849 X:19802813-19802835 CTCCCCTCATGCTCTCCCCCGGG + Intronic
1194244315 X:91492968-91492990 CCACCCTCATGCAAAGGCACAGG + Intergenic
1194750241 X:97676339-97676361 CTCTCCTCATTGAATGGCCTTGG + Intergenic
1196485694 X:116204079-116204101 TTCCCTTCATGCATGGGCCCTGG + Intergenic
1200273769 X:154712567-154712589 CACCCCTCATGCCATGGCAGTGG - Exonic