ID: 1058175994

View in Genome Browser
Species Human (GRCh38)
Location 9:101737622-101737644
Sequence GCCCGGGGAGGGCGCCAGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 624}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058175994_1058176009 10 Left 1058175994 9:101737622-101737644 CCGCCCTGGCGCCCTCCCCGGGC 0: 1
1: 0
2: 2
3: 48
4: 624
Right 1058176009 9:101737655-101737677 CCGGCGGCCCCCGGCCATGCAGG 0: 1
1: 0
2: 1
3: 16
4: 221
1058175994_1058176006 1 Left 1058175994 9:101737622-101737644 CCGCCCTGGCGCCCTCCCCGGGC 0: 1
1: 0
2: 2
3: 48
4: 624
Right 1058176006 9:101737646-101737668 TACGGGAGCCCGGCGGCCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 101
1058175994_1058176010 11 Left 1058175994 9:101737622-101737644 CCGCCCTGGCGCCCTCCCCGGGC 0: 1
1: 0
2: 2
3: 48
4: 624
Right 1058176010 9:101737656-101737678 CGGCGGCCCCCGGCCATGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 120
1058175994_1058176001 -9 Left 1058175994 9:101737622-101737644 CCGCCCTGGCGCCCTCCCCGGGC 0: 1
1: 0
2: 2
3: 48
4: 624
Right 1058176001 9:101737636-101737658 TCCCCGGGCTTACGGGAGCCCGG 0: 1
1: 0
2: 1
3: 6
4: 81
1058175994_1058176005 -6 Left 1058175994 9:101737622-101737644 CCGCCCTGGCGCCCTCCCCGGGC 0: 1
1: 0
2: 2
3: 48
4: 624
Right 1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058175994 Original CRISPR GCCCGGGGAGGGCGCCAGGG CGG (reversed) Exonic
900003597 1:29438-29460 GCTCGGGGAGGGCGCAGTGGAGG - Intergenic
900014172 1:137389-137411 GCCCCGGGAGGCCGCCGTGGGGG + Intergenic
900023315 1:199954-199976 GCTCGGGGAGGGCGCAGCGGAGG - Intergenic
900044035 1:492591-492613 GCCCCGGGAGGCCGCCGTGGGGG + Intergenic
900065445 1:727497-727519 GCCCCGGGAGGCCGCCGTGGGGG + Intergenic
900120420 1:1046482-1046504 CCAGGGGGAGGGCGCCGGGGGGG - Exonic
900180290 1:1308181-1308203 GCGCGGGGAGGGCGCGGGGAGGG + Intronic
900299244 1:1968914-1968936 CCCCCAGGAGGGCGCTAGGGAGG - Intronic
900550699 1:3252957-3252979 GCCCGGTGTCGGAGCCAGGGAGG - Intronic
900595086 1:3476858-3476880 GCCTGGGGCAGGCGTCAGGGCGG + Intronic
900658770 1:3772730-3772752 GCCTGGGCAGGGGGCGAGGGCGG - Intergenic
900735125 1:4294953-4294975 TCCTGGGTAGGGAGCCAGGGGGG + Intergenic
900956918 1:5891960-5891982 GCCCAGGGTGGGCCCCAAGGGGG + Intronic
901013076 1:6211846-6211868 GCCTGGGGAGAGAGCCAGTGTGG - Exonic
901109867 1:6785707-6785729 GGCCGGGGAGGGGGCCGGCGGGG + Intronic
901261080 1:7871402-7871424 GCCTGGGCAGGGGGCCTGGGAGG - Intergenic
901344071 1:8523099-8523121 GCCTAGGGAGGTCCCCAGGGAGG + Intronic
901626766 1:10629281-10629303 GCCCAGGGTGGGGGCCCGGGGGG + Intronic
901636452 1:10672483-10672505 GCCCGGGGAGGGGGGCGGGCCGG - Intronic
901929527 1:12588103-12588125 GCCCGGGCCGGGCACCAGGTAGG - Intronic
902385579 1:16073662-16073684 GCCAGGGGAGGGCGACACCGCGG + Intergenic
902929092 1:19717724-19717746 AGGCAGGGAGGGCGCCAGGGAGG - Intronic
903179484 1:21598063-21598085 GCCTGGGGAGGGGGGCAGGAGGG + Exonic
903191337 1:21657965-21657987 CCCCCCAGAGGGCGCCAGGGTGG + Intronic
903741971 1:25563594-25563616 GCCCAGGGAGGGGGCCAGGAAGG + Intronic
903774662 1:25785118-25785140 TCCCAGGGAGGGCATCAGGGAGG - Exonic
904306758 1:29594858-29594880 GGCAGGGGAGGGCGCCCTGGAGG + Intergenic
904494006 1:30876723-30876745 GGGCGGGGAGGGCGCCTCGGGGG + Exonic
905011341 1:34748999-34749021 AGCCAGGGAGGGTGCCAGGGAGG - Intronic
905106167 1:35564807-35564829 GCCAGAAGAGGGCGCCAGAGAGG - Intronic
905847192 1:41242452-41242474 GGCCTGAGAGGGCGCGAGGGCGG + Intergenic
906608978 1:47189326-47189348 GCCCTGGGAGGTGGGCAGGGTGG + Intronic
906612640 1:47213938-47213960 GCCCGTGGGGGGCACCAAGGAGG + Intergenic
907242329 1:53087732-53087754 GCCCGGTGAGGGCGGCAGGCAGG - Exonic
908354912 1:63319696-63319718 GGCCGGGGAGGGCGACAGGAAGG - Intergenic
909562805 1:77024613-77024635 GCCAGGGAAGGTCTCCAGGGCGG + Intronic
910138324 1:83998845-83998867 GCCCGGAAAGAGGGCCAGGGCGG + Intronic
910721427 1:90290566-90290588 GGCCGGGGAGAGCAGCAGGGAGG + Intergenic
912411562 1:109483912-109483934 GCGCGGCGGCGGCGCCAGGGCGG + Intronic
913222027 1:116667556-116667578 CCCCGGGGAGGGAGGCGGGGAGG - Intronic
913222036 1:116667568-116667590 GCCCGGAGGGGGCCCCGGGGAGG - Intronic
914386289 1:147172693-147172715 GCCAGGAGGGGGCGCCAGGCAGG + Intergenic
914743861 1:150486903-150486925 GACCGGGGGGGGCGGGAGGGGGG - Intergenic
914753167 1:150549348-150549370 GGCGGGGGCGGGCGCGAGGGCGG + Exonic
914913722 1:151805588-151805610 GACAGGGGAGGGAGCCAGGAGGG + Exonic
914993094 1:152515457-152515479 CGCCGGGGTGGGCGCCGGGGCGG - Exonic
915116983 1:153607470-153607492 GCCTGGGGAGAGCACCAGGGCGG + Exonic
915637060 1:157194859-157194881 CCCAGGGGCGGGCTCCAGGGCGG - Intergenic
916462001 1:165034832-165034854 GGCAGAGGAGGGCACCAGGGAGG + Intergenic
917749071 1:178038016-178038038 GCCCCGGGAGAGCGGAAGGGCGG + Intergenic
918487480 1:185045284-185045306 GACCGCGGTGGGCGCCGGGGGGG + Intergenic
919830999 1:201539917-201539939 GCACTGGGCGGGCGCCAGAGAGG - Intergenic
920195321 1:204222671-204222693 GCAGGGGCAGGGGGCCAGGGTGG + Exonic
920352132 1:205344142-205344164 GCCCGGGGAGCGCGGCGGCGAGG + Exonic
920377767 1:205518536-205518558 GGGCGGGGAGGGCTCCAGGTAGG + Intronic
920431885 1:205924018-205924040 ACCCCAGGAGAGCGCCAGGGTGG - Intronic
920572011 1:207024567-207024589 GGCGGGGGAGGGAGTCAGGGAGG - Intronic
921838986 1:219808377-219808399 GTCCTGGGAGGTGGCCAGGGTGG + Intronic
922322808 1:224503033-224503055 TCCCGGGGAGGGAGGGAGGGAGG + Intronic
922734417 1:227971693-227971715 GCCCCGGGAGGCCGCCATGGGGG - Intergenic
922734706 1:227972825-227972847 GCCCCGGGAGGCCGCCATGGGGG - Intergenic
922822625 1:228494508-228494530 GCACAGGGAGGGCTCCTGGGAGG - Exonic
923107961 1:230868679-230868701 TCCCGGGGAGGGGGCCACGGAGG - Intronic
923145504 1:231194900-231194922 GGCCGGGGAGTGCGGCAGGGAGG + Intronic
924007746 1:239630893-239630915 GCCGGGGGAGGGCAGCAGTGGGG + Intronic
1063367784 10:5501472-5501494 GCCTGGTGAGGGGCCCAGGGAGG + Intergenic
1063504148 10:6580562-6580584 GCCCCGGGAGGGCGGCGAGGCGG + Intergenic
1065342897 10:24723403-24723425 GCCCGCGGCGGGCGCCCGGCGGG - Intronic
1066044647 10:31584595-31584617 GCCTGGGGAAGGTGACAGGGTGG - Intergenic
1066732617 10:38449140-38449162 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1067314749 10:45151099-45151121 GCCTGGTGAGGGCACCATGGAGG + Intergenic
1067414204 10:46091462-46091484 GCCCAGGAAGGAGGCCAGGGAGG - Intergenic
1067434255 10:46265977-46265999 GCCCAGGAAGGAGGCCAGGGAGG - Intergenic
1067439436 10:46300352-46300374 GCCCAGGAAGGAGGCCAGGGAGG + Intronic
1067769908 10:49115562-49115584 GCCGGGGGCGGGCGCGAGCGCGG - Intergenic
1069438538 10:68407312-68407334 GCGGCGGGAGGGCGCCCGGGCGG + Intergenic
1069651610 10:70053452-70053474 GCCCGGGGAGGGCCGCTCGGGGG + Intronic
1069705537 10:70457003-70457025 GGCAGGGGAGGGGGGCAGGGGGG - Intergenic
1069942364 10:71964413-71964435 GAGCGGGGAGGGCGCCAGGCAGG + Exonic
1069986238 10:72286217-72286239 ACCCAGGGAGGGCGACCGGGTGG - Intergenic
1070160956 10:73866379-73866401 GCCAGGTCAGGGGGCCAGGGAGG + Intronic
1070800603 10:79242695-79242717 GCCCGAGGAGGCCGCCGGGAAGG - Intronic
1070942120 10:80357070-80357092 GCCAGGGGAGGGGGCCAGAGAGG + Intronic
1071501820 10:86209817-86209839 GACCTGGGAGGGAGCCAGGCAGG - Intronic
1071618178 10:87094980-87095002 GCCCGGGGAGGCCGCGGCGGAGG - Intronic
1072970136 10:100010046-100010068 GCGCGGGGCGGGCGCCGGAGAGG - Intergenic
1073097487 10:100988603-100988625 GCGAGGGGATGGGGCCAGGGAGG + Exonic
1073196297 10:101694700-101694722 GCGGCGGGAGGGCGCCAGGCCGG - Exonic
1073473037 10:103735680-103735702 GCTCGGGGAGGGCTTCAGGGAGG - Intronic
1074377741 10:112952595-112952617 GCCCGTCGTGGGCCCCAGGGGGG + Intronic
1074618655 10:115094107-115094129 GGCGGGGGAGGCCGCGAGGGGGG - Intronic
1074996957 10:118766121-118766143 GCCTGGTGAGGAGGCCAGGGAGG + Intergenic
1075139471 10:119818543-119818565 GCGGGGGAGGGGCGCCAGGGTGG - Intronic
1075702118 10:124476519-124476541 GCCTGGTGCGCGCGCCAGGGTGG + Intronic
1075885545 10:125896360-125896382 GGCCGCGGGGGCCGCCAGGGAGG + Intronic
1076156811 10:128210994-128211016 GCCCGGGGGAGGCGCCCTGGAGG - Intergenic
1076864161 10:133159262-133159284 GACCAGGGTGGGCCCCAGGGTGG + Intergenic
1076864359 10:133159946-133159968 GCCCGGGGTGGGGGGCGGGGCGG - Intergenic
1076864611 10:133160614-133160636 GTCCGCGGAGAGCGCCCGGGGGG + Intronic
1076887994 10:133271327-133271349 GGCCGGGCTGGGCTCCAGGGCGG + Intronic
1076916040 10:133423557-133423579 GCCCGGGGAGGGGTCCGCGGGGG - Exonic
1077010464 11:377040-377062 GCCCGGGGAGGGCGAAGAGGAGG + Exonic
1077060091 11:614141-614163 GCCCGGGGAGGGGGGGAGCGCGG - Intronic
1077089239 11:770975-770997 AGCCGGTGAGGGCACCAGGGTGG - Exonic
1077517394 11:3010220-3010242 GCCCCGGGAGGGCGCTAAAGGGG - Intronic
1077546871 11:3175715-3175737 GCTTGGAGAGGGGGCCAGGGAGG + Intergenic
1078514148 11:12008680-12008702 GCCAGGGGCGGGCGGCGGGGCGG - Intronic
1080036746 11:27719401-27719423 GCCGGGCGAGGGGGCCTGGGCGG - Intronic
1080836271 11:35943974-35943996 GCCCGGGGAAGGCGGGAGGGAGG + Intronic
1081871728 11:46385762-46385784 GCCCGGGGAGGCCGCCCGGGAGG - Exonic
1082260033 11:50071648-50071670 GCCTGGAGAGGCCGCCAGGAGGG + Intergenic
1082787374 11:57324488-57324510 GCCGGGGGAGGGGGCTAGCGCGG + Intronic
1083246279 11:61430206-61430228 GTCCGGGGCGGGCGGCAGCGGGG + Intronic
1083258294 11:61509740-61509762 GCCCGCGCTGGGCGCCGGGGCGG - Exonic
1083618208 11:64036507-64036529 GCCCGTGGGGGGCGTCAGGCCGG + Intronic
1083922137 11:65786823-65786845 GCCCGGGCGGGGCGGCCGGGCGG - Intergenic
1084028436 11:66467023-66467045 GCCAGGTGAGGCCGCCGGGGCGG + Exonic
1084035828 11:66509733-66509755 GCCTGGGGAGGGGGCAAGGAGGG + Intronic
1084673772 11:70622583-70622605 CCAAGGGGAGGGCACCAGGGTGG - Intronic
1084786061 11:71442233-71442255 GCCTGGGGAGGGTGGAAGGGAGG + Intronic
1084916721 11:72434248-72434270 GCCACCGGGGGGCGCCAGGGAGG - Exonic
1085724371 11:78941576-78941598 GCCCTGGCACGGCGCCGGGGCGG + Intronic
1087785254 11:102347155-102347177 GCCGCGCGAGGGCGCCCGGGAGG - Intergenic
1088801917 11:113314524-113314546 GCCCGGGGCGGGACCAAGGGCGG - Exonic
1088823523 11:113475426-113475448 GCGCGGGGAGCGCGGGAGGGAGG + Intronic
1088893040 11:114059537-114059559 GCCCGGGGACGGCGCGGGAGGGG + Intergenic
1089455072 11:118621335-118621357 GCGGGGGAAGGGAGCCAGGGAGG - Intronic
1089490492 11:118880429-118880451 GCCTGGAGAGGGGGACAGGGTGG - Intergenic
1090186006 11:124739724-124739746 GCCAGGGGATTGCGCCCGGGAGG + Intergenic
1090363108 11:126186831-126186853 GCCTGGGGAGGCTGCAAGGGAGG + Intergenic
1090385389 11:126355393-126355415 GCCTGTGAATGGCGCCAGGGTGG - Intergenic
1091377014 12:31492-31514 GCTCGGGGAGGGCGCAGCGGAGG - Intergenic
1091403655 12:196069-196091 TCCAGGGGAGGGAGCCACGGGGG - Intronic
1091434015 12:459901-459923 GCCCGGGGCGGGGGCGGGGGCGG + Intergenic
1091599143 12:1907631-1907653 GCCCGGTGAGGGTGCCTGGTGGG + Intronic
1092247913 12:6873527-6873549 GCCCGGGGTGGGCTCCACGGGGG - Intronic
1092849280 12:12612119-12612141 GCCGGGGGAGGGCTCCGGGAGGG + Exonic
1094497534 12:30997867-30997889 ACCCGGGGAGGTCCCCAGGCAGG + Intergenic
1095990455 12:48030660-48030682 GCCCCGGGAGGTAGACAGGGAGG - Intergenic
1096078417 12:48818628-48818650 TCCCGGGGAGGGGGTCAGGTGGG + Intronic
1096157359 12:49347929-49347951 GGCCGGGGAGGGCCCTGGGGAGG + Exonic
1096561524 12:52439129-52439151 GCCCTGGGAGGGCCCCTGAGAGG - Intergenic
1096647809 12:53047876-53047898 GCCCAGGGAAGGAGCGAGGGAGG - Intronic
1096777877 12:53974835-53974857 GCCCAGGAAGGGCCCGAGGGCGG + Intronic
1096983608 12:55743116-55743138 GGCCGGGGCGGGCGGCTGGGGGG - Intergenic
1097157488 12:57023493-57023515 GGCCGGGGAGGGGGCAGGGGTGG - Intronic
1097872095 12:64610396-64610418 GTCCGGGGCGGGGCCCAGGGAGG + Intergenic
1097990265 12:65825602-65825624 GCCCGGGGAAGGCGGGAGGTGGG + Intronic
1098595836 12:72272595-72272617 GCCCGCGGGGGGTGCCAGAGGGG + Intronic
1098963604 12:76763910-76763932 GCCCGGGGGAGGCGGCCGGGCGG - Exonic
1100405798 12:94272077-94272099 GCCCGGGAAGAGGGCCAGGCTGG - Intronic
1100869467 12:98895073-98895095 GCCCGGGGTGGGCGGCGAGGCGG + Intronic
1102518133 12:113463625-113463647 ACCCGGGGAGGGGACCCGGGCGG + Intronic
1102960108 12:117086986-117087008 GCCTTGGGAGGGAGGCAGGGAGG + Intronic
1103410775 12:120710346-120710368 GGCGGGGGCGGGCGCCCGGGGGG - Intergenic
1103528037 12:121580393-121580415 GGGCGGGGAGGGAGCCCGGGAGG + Intronic
1103547522 12:121712717-121712739 GGGCGGGGCGGGCGCCGGGGCGG + Intergenic
1103719573 12:122966133-122966155 GCTCCGGGAGGGCTCCAGGGAGG + Intronic
1103853129 12:123946350-123946372 GCCATGAGAGGGCACCAGGGTGG - Intronic
1103876028 12:124127885-124127907 GCCCCGGGAGGTCTCCAGGAAGG + Intronic
1104821403 12:131679454-131679476 GCACGGGGTGGAGGCCAGGGAGG + Intergenic
1104824068 12:131695882-131695904 GACCAGGGAAGGGGCCAGGGAGG - Intergenic
1104887035 12:132116910-132116932 GCGCAGGGCGGGCGCCGGGGCGG - Intronic
1104892843 12:132148670-132148692 GGCCGGGGAGGGGGCGGGGGCGG + Intronic
1104901094 12:132189884-132189906 GGCCGGGGGAGGCGCCGGGGAGG - Intergenic
1104941448 12:132397382-132397404 GCCCAGGAGGGGCCCCAGGGAGG - Intergenic
1104950725 12:132438749-132438771 GAGCTGGGAGGGCTCCAGGGTGG + Intergenic
1104975569 12:132550492-132550514 GCTCGGGGAGAGCAGCAGGGTGG + Intronic
1105011827 12:132761550-132761572 GCCCGAGGAGGGCGTCGGGGCGG + Intronic
1105012018 12:132762113-132762135 GCCCGGGGAGGCCACCAGGGCGG + Intergenic
1105054036 12:133080889-133080911 GCCCGCGGAGGGGCCCTGGGGGG + Exonic
1105704841 13:22962399-22962421 GCCTGGGGAAGGCCCCATGGAGG - Intergenic
1105857801 13:24387557-24387579 GCCTGGGGAAGGCCCCATGGAGG - Intergenic
1110236379 13:73221750-73221772 GCCTGGGGAGGGGGCAAGGAAGG - Intergenic
1110450842 13:75636251-75636273 GCCCCGGGAGGGCGGTGGGGTGG + Intronic
1110573082 13:77026983-77027005 TCCCGCGGAGGGCGCCAACGCGG + Exonic
1110887263 13:80655174-80655196 GCCCGGCGGGGGCGGCAAGGTGG + Intergenic
1111889886 13:94068862-94068884 GCCCGTGAAGGGAGCCAGGAGGG - Intronic
1112768829 13:102773909-102773931 GCTAGGGGAAGGTGCCAGGGTGG + Intergenic
1113200753 13:107866189-107866211 TCCCGGGGAGGGGGGCAGGGTGG + Exonic
1113593831 13:111518057-111518079 GGCAGGTGAGGGAGCCAGGGGGG - Intergenic
1113872219 13:113566253-113566275 GGCCGGGGCGGGCGACAGCGGGG + Intergenic
1114519046 14:23321571-23321593 GGCCGGGGAGGGGGCCCCGGGGG + Exonic
1116997355 14:51337593-51337615 GCCCAGGCAGGGCCTCAGGGTGG + Intergenic
1117495076 14:56294631-56294653 GCCCAGGCAGGGTCCCAGGGAGG - Intronic
1117750790 14:58921707-58921729 GGCAGGGGAGGGCGGCAGGGAGG - Intergenic
1118115203 14:62768047-62768069 GACTTGGGAGGGTGCCAGGGTGG + Intronic
1118752375 14:68816536-68816558 GCCGGGGCAGAGCGCCAAGGAGG - Intergenic
1118930369 14:70234869-70234891 GCCCAGGGAGGGTGACAGGCGGG - Intergenic
1119286389 14:73458353-73458375 GGCCGGGGCCGGGGCCAGGGCGG - Intronic
1119298495 14:73552476-73552498 GCCTGGGAAAGGGGCCAGGGTGG - Intronic
1119302792 14:73584663-73584685 GCCTGGGAAAGGGGCCAGGGTGG - Intergenic
1119325934 14:73759622-73759644 GCCCGGAGAGGGGGCCGCGGGGG - Intronic
1119622120 14:76138953-76138975 GCCCGGGCAGCGCGCGCGGGGGG + Intergenic
1119704665 14:76776301-76776323 GGCGGGGGAGGGGGCGAGGGAGG - Intronic
1120979608 14:90278557-90278579 GGCCGTGGAGGGCGACAGGAGGG - Intronic
1121257077 14:92538967-92538989 CCCCTGGGAGGGGGCCTGGGAGG - Intronic
1121273411 14:92652251-92652273 GTCCGGGGATGGCGGCAGAGGGG + Exonic
1121327113 14:93027531-93027553 GAGCTGGGAGGGGGCCAGGGAGG + Intronic
1121718319 14:96091730-96091752 GCCTGTGGAGTGGGCCAGGGTGG - Exonic
1122162444 14:99793811-99793833 ACCCGCGGAGCGCGCCCGGGCGG + Intronic
1122422186 14:101584569-101584591 GCCCGTGGACGGCGCCAGCTCGG - Intergenic
1122445167 14:101762203-101762225 GCCCGGGGAGGGGGTCGGAGGGG + Intronic
1122455173 14:101844525-101844547 GCCCGGGGATGACAGCAGGGAGG - Intronic
1122598889 14:102911550-102911572 GCCCGGGGAGTCCGGCAGGAGGG - Intergenic
1122795296 14:104203085-104203107 GGCCAGGGAGGGAGCCAAGGAGG - Intergenic
1202872521 14_GL000225v1_random:177580-177602 GGCCGCGGGGGCCGCCAGGGAGG - Intergenic
1123948096 15:25248602-25248624 GCTTGGAGAGGGCACCAGGGTGG + Intergenic
1123964233 15:25439069-25439091 GCCGGGCGAGGGCTCCAGGCCGG + Intergenic
1124142284 15:27088242-27088264 GCTCGGGGCGGGCGCGGGGGCGG + Intronic
1124477030 15:30044558-30044580 GCCCGGGGAGGGCGGGCCGGGGG + Intergenic
1124597326 15:31101976-31101998 GCCAGGGAAGGGCGGCTGGGTGG - Intronic
1125577752 15:40766894-40766916 GCCCAGGGAGGGCGGCAGCAGGG + Exonic
1126837252 15:52679438-52679460 GGCCGCGGAGGCCGCCGGGGAGG - Intronic
1127083992 15:55408044-55408066 GCCCGAGGAGGTCGCCCGTGCGG + Intronic
1128067598 15:64774757-64774779 TCACGGGGAGGGGGTCAGGGCGG + Intronic
1128181717 15:65610967-65610989 GCGCGGGGCGGCCGCCACGGTGG + Intronic
1128374435 15:67065459-67065481 CTCCGGGGAGGGCGCCCGGCCGG - Intronic
1128374629 15:67066132-67066154 GGCTGGGGAGGGCGCGCGGGCGG - Exonic
1128736697 15:70057661-70057683 GCGAGGGGTGGGCGTCAGGGAGG + Intronic
1129228588 15:74183988-74184010 TCCTGGGGTGGGAGCCAGGGAGG + Exonic
1129769877 15:78196092-78196114 GACAGGGGAGGGTGCCAGAGAGG + Intronic
1129803881 15:78438295-78438317 CTCCGGGGAGGGGGCCAGCGGGG - Exonic
1130076705 15:80695654-80695676 GCCCGAGGAGGGCGCGGGCGCGG + Exonic
1130220875 15:82018482-82018504 GCCAGGGGAAGGGGCCAGGCAGG - Intergenic
1130295971 15:82647396-82647418 GCGCGGTGGGGGCGCCCGGGCGG - Intronic
1130538228 15:84802189-84802211 GCCAGAGGAGGGCTCCGGGGAGG + Exonic
1131520415 15:93109985-93110007 GCCCGGGGAGGGGGTCGGGCTGG + Intergenic
1131838995 15:96416602-96416624 GGCTGGGTAGGGCGCCTGGGAGG + Intergenic
1132327552 15:100984487-100984509 GCCAGGGGAGGGAGGGAGGGAGG - Intronic
1132449906 15:101961502-101961524 GCTCGGGGAGGGCGCAGCGGAGG + Intergenic
1132671140 16:1102761-1102783 GCTGGGGGAGGGCGTCTGGGGGG - Intergenic
1132671172 16:1102840-1102862 GCTGGGGGAGGGCGTCTGGGGGG - Intergenic
1132671213 16:1102916-1102938 GGCCGGGGAGGGAGCCGGGAGGG - Intergenic
1132783340 16:1640894-1640916 GCCTGAGGAGGGGGCCAGGCAGG + Intronic
1132786249 16:1658415-1658437 CCCCAGGGAAGGGGCCAGGGTGG + Intronic
1132889406 16:2196556-2196578 GCCCGAGGAGGGCGAAGGGGCGG - Intergenic
1132893247 16:2214825-2214847 GGGCGGGGAGGGCGCCGCGGCGG - Intergenic
1132934429 16:2473672-2473694 GCACGGGGAGGACACCAGGAGGG - Intronic
1132981983 16:2742892-2742914 GCCCGGGGATGGAGCCTGAGGGG + Intergenic
1133103403 16:3492604-3492626 GGTCAGGGAGGGCACCAGGGAGG - Intergenic
1134781017 16:16895694-16895716 GCCGGGGGAGGGGGGCGGGGTGG - Intergenic
1134860012 16:17552745-17552767 GCCTGGGGAGGGAGGCAGTGTGG - Intergenic
1135049450 16:19180627-19180649 GCTGGGGGAGGGCGGCAGAGTGG + Intronic
1135303407 16:21349745-21349767 GCCAGGGGAGGGCCCCAGTGTGG + Intergenic
1135382680 16:22007964-22007986 GTGCGGGGAGGGGCCCAGGGCGG + Intronic
1135418952 16:22291515-22291537 GCCTGGGAAGGGGTCCAGGGGGG - Intergenic
1135573272 16:23565842-23565864 GCAGGGGGAGGGGGGCAGGGAGG - Intronic
1136186810 16:28593159-28593181 GCCCAGGGAGGGTGGCTGGGTGG + Intronic
1136300155 16:29328939-29328961 GCCAGGGGAGGGCCCCAGTGTGG + Intergenic
1136365007 16:29805977-29805999 GCGCGGGGAGGGCGGGCGGGGGG - Intergenic
1136365130 16:29806294-29806316 GGCGGGGGAGGGCGCGAGGGAGG - Intronic
1136365182 16:29806423-29806445 GCCGGGGGCGGGGGCCCGGGCGG - Intronic
1136382070 16:29900415-29900437 GCCCGGAAAGGGCGCCACGTGGG - Intronic
1136398486 16:30005472-30005494 GCACGGGGAGGGCGCCGGGCGGG - Exonic
1136580797 16:31149786-31149808 GCTGGGGGAGGGAGTCAGGGAGG - Intronic
1137261000 16:46830581-46830603 GACCGGGGCGGGCGCCTGAGTGG - Intronic
1137288792 16:47037773-47037795 CCCGCGGGAGGGCGCCGGGGAGG + Intergenic
1137708008 16:50548589-50548611 GCCCGGGGCGAGCGCGCGGGCGG - Intronic
1138179311 16:54931356-54931378 GCCCGGCGAGGGCGCCGTGAAGG - Exonic
1139390845 16:66605490-66605512 GGCCGGGGTGGGGGCGAGGGCGG - Intronic
1140092566 16:71850303-71850325 GGCCGGGGAGGGAGCCTGTGGGG - Exonic
1140478735 16:75251453-75251475 ACCTGGTGAGGGCGCCAGGTGGG - Intronic
1141430604 16:83968741-83968763 GCGCTGGGTGGGCGCCAGGATGG + Exonic
1141678738 16:85531609-85531631 GCCGGGGCAGGGCGGAAGGGGGG - Intergenic
1141700114 16:85638635-85638657 GGCGGGGGTGGGAGCCAGGGTGG - Intronic
1141912634 16:87070588-87070610 CCCCAGGGAGGACACCAGGGTGG - Intergenic
1142008997 16:87704319-87704341 GCCTGGGGAGGGCCCTGGGGAGG + Intronic
1142009060 16:87704516-87704538 GCCTGGGGAGGGCCCTGGGGAGG + Intronic
1142061886 16:88035709-88035731 GCCAGGGGAGGCCCCCAGTGTGG + Intronic
1142065180 16:88058315-88058337 GCCCGAGGAGGACGGCAGGCAGG + Intronic
1142124920 16:88405491-88405513 GCTGGGGGAGGACGCCAGGGAGG - Intergenic
1142194755 16:88734285-88734307 GGCCAGGGAGGGAGCCAGGTGGG - Intronic
1142429598 16:90019141-90019163 GCGCGGGGACCGCGCCCGGGAGG + Intronic
1142449879 16:90168416-90168438 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1142457207 17:63430-63452 GCCCCGGGAGGCCGCCGTGGGGG + Intergenic
1142596374 17:1031853-1031875 GCGCGGGGAGGGAGGGAGGGAGG - Intronic
1142604473 17:1073943-1073965 GCCTGGGGAGGGGGGCGGGGCGG - Intronic
1142859970 17:2755591-2755613 GCGCGGGGAGGGCGCGGGGAGGG - Intergenic
1142859975 17:2755602-2755624 GCGCGGGGAGGGCGCGGGGAGGG - Intergenic
1143484011 17:7243091-7243113 GGCTTGGGAGGGCGCCGGGGAGG + Intronic
1143521220 17:7445405-7445427 GCCTGGTGAGGGCGCGCGGGGGG + Exonic
1143596245 17:7916003-7916025 GCGCGGGGACGGCGGCGGGGCGG - Intergenic
1143893972 17:10122521-10122543 GGTGAGGGAGGGCGCCAGGGAGG - Intronic
1144586674 17:16491718-16491740 GCGCGGGGAGGGGGCGCGGGGGG - Intronic
1146654460 17:34626818-34626840 GCCCGGGGTGGGGGCCCGAGCGG + Intronic
1147168486 17:38605381-38605403 CCCCGGGGTGGGGGCCAGAGGGG - Intronic
1147393310 17:40122782-40122804 GCCCTGGGAGGAGGCCAGCGGGG - Intronic
1147609275 17:41792171-41792193 GCCCTGGCTGGGGGCCAGGGAGG + Intergenic
1147967185 17:44199652-44199674 GCCCGGTGAGGCGGCCAGGCGGG - Intronic
1148019162 17:44542197-44542219 CCCTGGGGAGGGGACCAGGGAGG - Intergenic
1148431922 17:47649908-47649930 GCGCAGGGAGGGAGCGAGGGAGG - Exonic
1148451165 17:47778555-47778577 ACCCGGGCCGGGGGCCAGGGAGG + Intergenic
1148693736 17:49547110-49547132 GTCCAGGGAGGGGGGCAGGGGGG + Intergenic
1148782594 17:50130077-50130099 GGCGGGGGAGGGCGGCGGGGAGG + Intergenic
1148846499 17:50532994-50533016 TGCCAGGGAGGGGGCCAGGGAGG - Intronic
1149800805 17:59565691-59565713 TCGCGGGCAGGGCGCCAAGGCGG + Exonic
1151452070 17:74203971-74203993 ACCCCGGGAAGGCGCCAGGCAGG - Intronic
1151652112 17:75476425-75476447 GCCCTGGAAGGGCGGGAGGGAGG - Intronic
1151747590 17:76019545-76019567 GCTCTGTGGGGGCGCCAGGGGGG + Exonic
1151919182 17:77140973-77140995 TTCCGGGGAGGGGGCCGGGGAGG - Intronic
1152254250 17:79228194-79228216 GCCCACGGATAGCGCCAGGGAGG - Intronic
1152321653 17:79611339-79611361 GGCCGGGGAGGGCGGCGGAGCGG + Intergenic
1152628841 17:81400562-81400584 GCCCGGGGAGGAGGGCAGCGCGG + Intronic
1152741561 17:82020657-82020679 GCCCGGGGTGGGGGGAAGGGAGG + Intronic
1152812556 17:82388845-82388867 TTCCGGGGAGGGCTCCGGGGAGG - Intergenic
1152878326 17:82801017-82801039 GCCTGGGGAGGGCCACGGGGTGG + Intronic
1153299458 18:3580555-3580577 GCCAGAGGAGGGCTCCGGGGAGG + Intronic
1154005768 18:10526227-10526249 ACCCGGGGGGGGCGGGAGGGAGG + Intronic
1155087041 18:22468717-22468739 GCCAGGGGATGGGGGCAGGGTGG + Intergenic
1155932703 18:31724052-31724074 GGCCGGGCAGGGCGGAAGGGAGG + Intergenic
1158962323 18:62596950-62596972 GCCCGGAGAGGGAGGCACGGAGG + Intergenic
1159102341 18:63970599-63970621 GCCCCGGGAGGGCGAGTGGGAGG + Intronic
1160635350 19:71045-71067 GCTCGGGGAGGGCGCAGCGGAGG - Intergenic
1160647566 19:200535-200557 GCCCCGGGAGGCCGCCGTGGGGG + Intergenic
1160719206 19:590096-590118 GCCCGGGGCGGGTGCTGGGGGGG - Exonic
1160831935 19:1108303-1108325 GCTGGGGGAGGGCGCGGGGGCGG - Exonic
1160856314 19:1219420-1219442 GCGCGGGGCAGGGGCCAGGGTGG + Intronic
1160937825 19:1605490-1605512 GCGCGGGGAGGGCGGGGGGGGGG + Exonic
1160951884 19:1671823-1671845 GCCGGGGGAGGGCGCGGTGGGGG - Intergenic
1160961946 19:1725955-1725977 GCGCGGGGAGGGGGCCCGAGAGG + Intergenic
1160968153 19:1755548-1755570 GCGCGGGGCGGGCGCCGGGTCGG - Intronic
1160972540 19:1775922-1775944 CCCTGGGGAGGGGGCCGGGGCGG - Exonic
1161030935 19:2057507-2057529 GCCTGGTGAGGGCTCCAGGGTGG - Intergenic
1161272730 19:3398853-3398875 GCCCGTGGAGGGAGCCGCGGGGG - Intronic
1161290871 19:3492680-3492702 GGCTGGGGAGGGCCTCAGGGAGG + Intronic
1161301647 19:3545565-3545587 GCCAGGGCAGGAAGCCAGGGAGG - Intronic
1161346359 19:3770589-3770611 GGCCGAGGAGGGGGCCCGGGAGG + Exonic
1161991407 19:7686261-7686283 GCCCGGGGTTGGGGCAAGGGAGG + Exonic
1162068494 19:8139921-8139943 GCAAGGGGAGGGGACCAGGGAGG - Intronic
1162100458 19:8335603-8335625 GCGCGGGGACGGCGCGAGGTCGG + Exonic
1162140074 19:8580406-8580428 GTCAGGGGAGGGTGTCAGGGAGG + Exonic
1162341867 19:10096185-10096207 GCCCGGGGCGGGCCCGGGGGCGG - Exonic
1162398771 19:10432385-10432407 GCATGGGGACGGCGGCAGGGCGG - Intronic
1162471021 19:10871975-10871997 GCCCGGGGCGGGGGCCGGCGGGG + Intronic
1162635688 19:11965435-11965457 GCCCAGAGAGGGCTCCGGGGCGG - Intronic
1162760786 19:12887075-12887097 GTCCGGGAAGGGGCCCAGGGCGG + Exonic
1163084289 19:14968367-14968389 TCCCGGGAAGGGCTCCAAGGAGG - Exonic
1163390480 19:17027184-17027206 GCCCGGGGAGGGGGCCATAAGGG - Intergenic
1163933881 19:20424241-20424263 GCCCAGAGAGGGCTCCAGGCCGG + Intergenic
1164781651 19:30897701-30897723 GCACTGGGAAGGGGCCAGGGAGG + Intergenic
1165012680 19:32860028-32860050 TCCCTGGGAGGGCCTCAGGGAGG - Intronic
1165750402 19:38256112-38256134 GCCCGGGGAGGGCTCGGGGGTGG - Intronic
1165961673 19:39539935-39539957 GGCCGGGGAAGGCGCGATGGCGG - Exonic
1166245380 19:41522081-41522103 GCCGGCGGAGGGGGCCCGGGCGG - Intergenic
1166390466 19:42406435-42406457 GCCTGGGGAGGAGGGCAGGGAGG + Intronic
1166569443 19:43784570-43784592 GCCCAGGGAGGGGCCAAGGGGGG + Intergenic
1166861713 19:45815298-45815320 GCGCGGGGAGCGGGCCAGGGTGG + Exonic
1166873142 19:45882822-45882844 GGCCGGGGAGGCCGCAGGGGTGG + Intergenic
1166882945 19:45940219-45940241 GGCCGGGGCGGGCGGCGGGGCGG - Exonic
1167111694 19:47466305-47466327 GGCCGGGGGAGGCGGCAGGGAGG + Exonic
1167145984 19:47681041-47681063 GACCGCGGGGGGCGCCTGGGGGG - Exonic
1167509483 19:49888533-49888555 GTCCGTGGAGGGCGGCGGGGTGG - Exonic
1167593831 19:50417533-50417555 CCCTGGGGAGGGGGCCAGGCTGG - Intronic
1167649007 19:50719531-50719553 GCCCGGGGAGGGGGCGGGCGGGG + Intergenic
1168094285 19:54105819-54105841 GCAGGGGGAGGGCAGCAGGGAGG - Intronic
1168340706 19:55621681-55621703 ACCCGGGGAGGGGGACGGGGTGG - Exonic
1168401221 19:56087229-56087251 GCCCGCGGAGGGCTCTAGGCAGG - Intergenic
1168462124 19:56567900-56567922 GCCCGGGGAAGTTGCCCGGGCGG + Exonic
1168691503 19:58380464-58380486 GCAGCGCGAGGGCGCCAGGGAGG + Intronic
925420046 2:3704114-3704136 GCCTGGGGAGGACACCTGGGGGG - Intronic
925814631 2:7735665-7735687 GACTGGGGAGGGTACCAGGGAGG - Intergenic
925814717 2:7736459-7736481 GACTGGGGAGGGTACCAGGGAGG - Intergenic
927591293 2:24360299-24360321 GCGCGGCGAGGGCGCCAGGTGGG - Exonic
927927536 2:27024311-27024333 GCCGGGGGAGGGAGCGTGGGGGG + Intronic
929452766 2:42048001-42048023 GCGGGGGCAGGGCGGCAGGGAGG + Exonic
931625094 2:64250260-64250282 GCCCAGTGAGGGCGCCAGTGTGG + Intergenic
931665870 2:64609306-64609328 GCGCGGAGAGGGCGCCTCGGAGG - Intergenic
933791859 2:85889178-85889200 ACCCGGGGCGGGGGCCAGGCTGG + Intergenic
934978595 2:98822803-98822825 GCTCGGGGCGGGCGCCGTGGAGG + Exonic
936433269 2:112482244-112482266 GGCCGCGGCGGGCGCCCGGGCGG + Exonic
936566132 2:113584002-113584024 GCTCGGGGAGGGCGCAGCGGAGG + Intergenic
937206007 2:120237630-120237652 TCCCTGGGAGGGCGCCTGGGAGG + Intergenic
937932791 2:127219441-127219463 TCCCGGGGAGGGACCCAGGCAGG - Intronic
937932979 2:127219954-127219976 GCCCCGGGAGGGAGCCAGCCCGG - Intronic
937991346 2:127664155-127664177 GCCCTGGGTTGGCGACAGGGTGG - Intronic
938383266 2:130848374-130848396 GCCCGTGCTGGGTGCCAGGGAGG + Intronic
938386780 2:130872446-130872468 GCCTGGGCAGGGGGCCTGGGGGG - Intronic
940833316 2:158492552-158492574 GCCCGGGCAGGGTGGCAGGAGGG - Intronic
941003077 2:160221588-160221610 GCCCGGGGAGGGAACCAGGCTGG + Intronic
941089646 2:161160257-161160279 GCTGGGGGAGGGCGCTAGGCGGG + Intronic
941295816 2:163736736-163736758 CCCCGGGGAGGGTGCCGGTGAGG - Intergenic
941367032 2:164621582-164621604 GGGCGGGGAGGGCGCGAGAGCGG + Exonic
942459038 2:176157133-176157155 GCCCGGCGCGGGGGGCAGGGAGG - Intronic
942566070 2:177265247-177265269 GCCCGGGAAGGGAGCAAGGGCGG - Intronic
942681388 2:178480758-178480780 GCCGGCGGAGGGGGCCCGGGCGG + Exonic
943646085 2:190408698-190408720 GCCGGGGGAGGGAGGGAGGGAGG - Intronic
944615237 2:201452237-201452259 GCGGGGAGAGGGCGCCCGGGCGG - Intronic
945066267 2:205949894-205949916 GCCCAGCGAGGGAGCCCGGGAGG + Intergenic
945108888 2:206344109-206344131 GCCCTGACAGGGCTCCAGGGAGG - Intergenic
946397131 2:219448813-219448835 GCTCGGAGAGGGCGGCTGGGCGG - Exonic
946407235 2:219498208-219498230 CCCCGGGCTCGGCGCCAGGGCGG - Intronic
946412622 2:219522720-219522742 GGCCGGGGAGGGGGCGACGGGGG - Intronic
947668521 2:231922483-231922505 GCCTGGGGAGTGCGCAATGGGGG - Intronic
948465767 2:238150960-238150982 GCCGGGGCAGGGCGCCGTGGCGG - Exonic
948477456 2:238229359-238229381 GCCCAGGCAGGGCTCCAGGGAGG + Intronic
948553454 2:238791464-238791486 GCCGGGGTAGGGGGGCAGGGTGG + Intergenic
948560471 2:238848200-238848222 GCGCCGGGCGGGCGCCATGGAGG + Exonic
948562980 2:238866239-238866261 GCCTGGGGAGCTCGCCATGGAGG - Intronic
948645457 2:239401184-239401206 GCCCGGGGCGGGCGGGCGGGAGG - Intronic
948666125 2:239535876-239535898 CCCCGGGGAGGGAGGCAGAGGGG - Intergenic
948874986 2:240821252-240821274 GCCCCTGCTGGGCGCCAGGGAGG - Intergenic
948991676 2:241558863-241558885 GGACGGGGCGGGCGCCGGGGCGG + Exonic
949052717 2:241905745-241905767 GAGCGTCGAGGGCGCCAGGGTGG - Intergenic
1168753398 20:299106-299128 GGGCGGGGAGGGCGGGAGGGGGG - Exonic
1169029293 20:2395497-2395519 GCCCTTGGAGGGGGCCTGGGAGG + Intronic
1170578314 20:17681098-17681120 GGCCGGGGCGGGCACCAGGCCGG + Intronic
1171123229 20:22582959-22582981 CCCCGGCGCGGGCGCCATGGCGG - Exonic
1171377085 20:24700826-24700848 GACTGGGGAGGGTCCCAGGGAGG - Intergenic
1172118054 20:32583520-32583542 GGCCGGGGAGGGAGCAAGGAGGG + Intronic
1172155316 20:32820045-32820067 GCCCGGGGGGTGCGGCTGGGGGG + Intronic
1172488511 20:35315333-35315355 GCGCAGGGAGGGTGTCAGGGAGG + Intronic
1172640892 20:36439864-36439886 GCCAGGTGAGGGTGGCAGGGAGG + Exonic
1172684917 20:36746155-36746177 GCGCGCCGAGGACGCCAGGGCGG + Intergenic
1173750390 20:45470918-45470940 GCTGGGGGAGGCCCCCAGGGAGG - Intronic
1174116643 20:48230924-48230946 ACCTGGGGAGGGTGCAAGGGTGG - Intergenic
1174140290 20:48408357-48408379 GCCTGGGGAGGGGGAGAGGGTGG - Intergenic
1174191284 20:48742523-48742545 GCCCAGGGAGGATGCCAGGAAGG + Intronic
1174898539 20:54475463-54475485 GCGCGGGGAGCGTTCCAGGGCGG + Intergenic
1175248150 20:57593561-57593583 GGCCCGGGAGGGCTACAGGGAGG + Intergenic
1175387618 20:58607502-58607524 GCACCTGGAGGGCTCCAGGGAGG + Intergenic
1175524862 20:59626638-59626660 GCCAGGGGAGGATCCCAGGGAGG + Intronic
1175730582 20:61351068-61351090 GCCCGGGGATGGAGGGAGGGCGG - Intronic
1175743948 20:61440725-61440747 GCCCGTGGCGGGCGCCATGGAGG + Intronic
1175889778 20:62310992-62311014 GCTCAGGAAGAGCGCCAGGGAGG + Exonic
1175926550 20:62474245-62474267 GCCCGGCGCCGGCGCGAGGGAGG + Intronic
1175928040 20:62480490-62480512 GCCCAGGAACGGCCCCAGGGAGG + Intergenic
1175947257 20:62564662-62564684 GCCCGGGCAGAGCGAGAGGGTGG + Intronic
1176005107 20:62857443-62857465 GCCCAGAGTGGGCCCCAGGGAGG - Exonic
1176029727 20:63006112-63006134 GTCAGGGCAGGGCCCCAGGGCGG + Exonic
1176030087 20:63007543-63007565 GGCCGGGGAGGGCGGGAAGGTGG + Intergenic
1176070276 20:63222610-63222632 GCCTGGGGAGGGCCACAGGTGGG + Intergenic
1176129219 20:63489197-63489219 GCACCGGGAGGGCGCCAGAGCGG + Intronic
1176168504 20:63686682-63686704 GGGCTGGGAGGGCGTCAGGGTGG + Intronic
1176266494 20:64212180-64212202 GGCCGTGGTGGGGGCCAGGGTGG + Intronic
1176266507 20:64212204-64212226 GGCCGTGGTGGGGGCCAGGGTGG + Intronic
1176266520 20:64212228-64212250 GGCCGTGGTGGGGGCCAGGGTGG + Intronic
1178695792 21:34792165-34792187 GCGCGCGGAGGGCGCCATGTTGG + Exonic
1179495176 21:41766830-41766852 GCCCGGGCGGGGCGCTGGGGCGG - Intronic
1179634964 21:42703038-42703060 GGCCGGGGTGGGGGCCATGGAGG + Intronic
1179939378 21:44628203-44628225 GCCCGGGGGGGAGGTCAGGGAGG - Exonic
1179988236 21:44932720-44932742 CCCCGGGGAGGCCGCTGGGGAGG - Intergenic
1180161436 21:46000226-46000248 GCCCTGTGGGGGCCCCAGGGAGG + Intronic
1180285577 22:10741896-10741918 GGCCGCGGGGGCCGCCAGGGAGG + Intergenic
1180699571 22:17774158-17774180 CGCCGAGGAGGGCGCCCGGGCGG + Intronic
1180700385 22:17778361-17778383 GCCCAGGGTGAGCGCCGGGGAGG - Intergenic
1181079710 22:20405747-20405769 GCGCGGGGCGGGCGCCGGGGAGG + Exonic
1181491474 22:23263054-23263076 GCGGCGGGAGGGCGCCAGGCCGG + Intronic
1181512212 22:23394116-23394138 GCCGGGGGTGGGTGCCAGGCTGG + Intergenic
1181555807 22:23671144-23671166 GCCCTGGGAGGGCCCCGGGTGGG + Intergenic
1181952133 22:26562124-26562146 GCCCGGCGGGGGCCACAGGGTGG + Intronic
1182443804 22:30379025-30379047 GCCCAGGAAGGGAGCCAGGCTGG + Exonic
1182448403 22:30403374-30403396 GCCCTGGGAGGGAGGCAGAGCGG + Intronic
1183258078 22:36775917-36775939 GGCAGGGGAGGGCTCCAGGTGGG + Exonic
1183294007 22:37019412-37019434 GGCCGGGGCGAGCGCCAGCGCGG - Exonic
1183358142 22:37370290-37370312 GCCTGGGCTGGGCCCCAGGGAGG - Exonic
1183370148 22:37427524-37427546 CGGCGGGGAGGGCGCCCGGGAGG + Intergenic
1183393722 22:37560351-37560373 TGCCGGGGAGGGGGCCGGGGAGG + Intergenic
1184254279 22:43278299-43278321 GCCAGGCAAGGGCGCCAGGCAGG - Intronic
1184383935 22:44163705-44163727 GCCCGGGGCGGGCCACAGGGTGG - Intronic
1184465870 22:44668712-44668734 GCCGGGGGAGGGGGCCGCGGAGG - Intronic
1184594110 22:45503681-45503703 GTCCCGGGAGGGAGGCAGGGAGG - Intronic
1184680738 22:46071190-46071212 GCCCGGGGCGGGCGGCGGGAGGG + Intronic
1184693978 22:46129777-46129799 GCACTGGGAGGGTCCCAGGGAGG - Intergenic
1184776815 22:46627478-46627500 GCCCTGGGTGGGAGCCAGGTGGG + Intronic
1184778738 22:46635738-46635760 GCCAGGGGCGGGGGGCAGGGAGG - Intronic
1184782029 22:46654367-46654389 GCCCTGAGAGGGTGCCTGGGTGG - Intronic
1184841448 22:47054707-47054729 GCCGGTGGTGGGCGCCTGGGAGG + Intronic
1185070286 22:48652315-48652337 GCCAGGGGTTGGCCCCAGGGTGG + Intronic
1185278760 22:49961052-49961074 GGCCGGGGCCGGGGCCAGGGCGG + Intronic
1185413388 22:50697414-50697436 GCGAGGGGAGGGCGGGAGGGAGG + Intergenic
1185418197 22:50721192-50721214 GGACCGGGAGGGCGCCTGGGAGG - Intergenic
949420501 3:3860283-3860305 GCCGTGGGTGGGGGCCAGGGAGG - Intronic
950046681 3:9952288-9952310 GCCCAGGGAGGGGGCGATGGCGG - Intronic
951017044 3:17742684-17742706 GCGCGGGGAGGGCGCGCGGCGGG - Intronic
951139873 3:19147505-19147527 CCCCGCGGGGGGGGCCAGGGGGG + Intergenic
951611327 3:24495100-24495122 GCCCGGGAAGCGGGCCGGGGCGG - Intronic
951981776 3:28575178-28575200 GCCCGGGGCGGGCGCCAGCTGGG - Intergenic
952966735 3:38625694-38625716 GCCCTGAGTGGGAGCCAGGGGGG + Intronic
953062417 3:39438459-39438481 GCCCAGGGAGGGAGGGAGGGAGG - Intergenic
953679272 3:45027306-45027328 GCCCCGGGAGGGCCTAAGGGAGG - Intronic
953908892 3:46882200-46882222 GGCCCGGGAGGGCGCGGGGGAGG + Intronic
954103721 3:48397949-48397971 CCCCGGAGAGAGCGGCAGGGTGG + Intronic
954210405 3:49093894-49093916 GCCGGGTGAGGGCTCCAGTGCGG - Exonic
957723237 3:84031718-84031740 GCCTGGGGAGAGCTCCAGTGAGG + Intergenic
958798622 3:98732491-98732513 GCCCGGCGAGGGCGCGCGGCTGG + Intronic
959085748 3:101849440-101849462 GGCCGGGCCGGGCGCCGGGGAGG + Intronic
960223758 3:115146973-115146995 GCCGGGGGAGGGGGCGCGGGCGG + Intronic
960971188 3:123141328-123141350 GCCCTGGGTGGCCTCCAGGGAGG - Intronic
961347095 3:126270365-126270387 GCCTGGGGAGGGTGCCAGGCTGG - Intergenic
961470766 3:127110136-127110158 GCCAGAGCAGGGGGCCAGGGAGG + Intergenic
961479697 3:127171864-127171886 GCCCTGGGGCTGCGCCAGGGAGG + Intergenic
961738990 3:129020781-129020803 TCCAGGGGAGGGAGCCAGGAAGG + Intronic
961862148 3:129925743-129925765 GGGCGGGGAGGGGGCAAGGGAGG + Intergenic
962840150 3:139225683-139225705 GCCTGGAGAGGGCCTCAGGGTGG + Intronic
965590347 3:170356776-170356798 GCCAGGGGAAGGCGTCTGGGTGG + Intergenic
965882043 3:173397775-173397797 GCGCGGAGAGCGCGCCCGGGCGG + Intronic
966874643 3:184315082-184315104 GCGCAGGGAGGGCGCAGGGGAGG + Intronic
967685068 3:192409072-192409094 GAGGGGGGAGGGCGCGAGGGAGG + Intronic
967762342 3:193240603-193240625 GCCGGGGGAGGGGGGCGGGGCGG + Intergenic
967973458 3:195016143-195016165 GCCTGGGTAGGGCACCATGGAGG - Intergenic
967978076 3:195046468-195046490 GCCAGGAGAGGGGGCCCGGGAGG + Intergenic
968093009 3:195909681-195909703 GCGCGGGGCGGGCGCCCGGCGGG - Intronic
968287089 3:197515066-197515088 GGCAGGGGAGGGCCCCAGGATGG - Intronic
968288100 3:197519897-197519919 GCCCGGGGAGCCAGCCACGGGGG - Intronic
968433680 4:574729-574751 GCCCGCAGAGGGGGCCAGGCCGG + Intergenic
968525698 4:1055564-1055586 GCCCAGGGGAGGCGCCTGGGAGG + Intergenic
968563487 4:1296987-1297009 GCCTGGGGAGGGCAGCAGTGTGG - Intronic
968585698 4:1414961-1414983 GCGCGGGGAGCGGGCGAGGGCGG - Intergenic
968626427 4:1628391-1628413 GCACGGGGAGGGTGGCATGGCGG + Intronic
968660028 4:1795013-1795035 GGCCGGGGAGGGCGCCTGGAGGG + Intronic
968702756 4:2064621-2064643 GTCTGGGCAGGGCGGCAGGGCGG - Exonic
968818146 4:2832350-2832372 CCCCGGGGAGAGCCCCAGGATGG + Exonic
968939620 4:3631121-3631143 GCCCTGGGAGGGTCCCAGTGTGG + Intergenic
969285707 4:6200670-6200692 GCCCGGGGCGGGGGCGGGGGCGG - Intergenic
972726752 4:41751692-41751714 GGCCGGGGAGGGTGCCCGGGGGG + Intergenic
973619472 4:52712562-52712584 CCGCGGGGAGGGCGCCCGGCCGG + Intergenic
973635901 4:52862079-52862101 GCCCAGGGTGGGCGCCTGGTAGG - Intergenic
973820412 4:54657830-54657852 GACCCGGGCGGGCGCGAGGGAGG + Intergenic
974412232 4:61556411-61556433 GCCGGGGGAGAGCAGCAGGGAGG + Intronic
978127168 4:105147833-105147855 GCCCGGGGAGGGGGCGGGAGGGG + Intronic
983228514 4:165107418-165107440 GCCTGGGGAGGGGGGCACGGAGG - Intronic
984524861 4:180846648-180846670 GCCCGGGGAGGGCAAAAGAGGGG + Intergenic
985794339 5:1950609-1950631 CCCCGGGCAGGAGGCCAGGGCGG - Intergenic
985825478 5:2187825-2187847 GTGCGGGGAGGGAGCAAGGGCGG - Intergenic
985971410 5:3381322-3381344 GCAGGGAGAGGGCTCCAGGGAGG - Intergenic
986330844 5:6714706-6714728 GCGCGGGGAGGCCGCGGGGGCGG + Intronic
986608655 5:9546257-9546279 GCCCGGGGAGGGGCTCGGGGAGG - Intergenic
987311516 5:16685670-16685692 GGACGGGGAGGGCGTCAGGATGG - Intronic
989732442 5:44664617-44664639 GCCCAGGGAGGGAGCTTGGGTGG + Intergenic
990950062 5:61289754-61289776 GCCCGGGGTGGGCATCAGTGAGG + Intergenic
991635179 5:68697497-68697519 GCCAGGGGTGGGGGGCAGGGAGG + Intergenic
992069524 5:73136311-73136333 CCCCGGGGAGGTCGCCGGGCAGG - Intergenic
992474227 5:77086997-77087019 GCCCCGCGCGGGTGCCAGGGAGG + Intronic
992778752 5:80109840-80109862 GCTGGGGGAGGGAGCCTGGGAGG - Intergenic
997297691 5:132777808-132777830 GCCCGGGAAGGCCGCCTGGCCGG - Intronic
997367669 5:133336221-133336243 GCTCGGGGAGGAGGCAAGGGTGG + Intronic
997461169 5:134053469-134053491 GCCAGGGGCAGGCGCCAGGAAGG + Intergenic
997774329 5:136586478-136586500 GCCAGGGGAGGGCAACAGGGAGG + Intergenic
998134669 5:139668411-139668433 GACCCGGGCGGGCGCCGGGGCGG - Intronic
998156375 5:139789058-139789080 GCCGGGGCAGGGAGCCACGGAGG - Intergenic
999300109 5:150485871-150485893 CCCCGGGGCGGGGGCCGGGGCGG - Intronic
1002517012 5:179766263-179766285 GCCCGGGGCTGGTGCCGGGGTGG - Exonic
1002729808 5:181326338-181326360 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1002928989 6:1620559-1620581 GCCGGGGAAGGGGGCGAGGGTGG + Intergenic
1003074494 6:2971433-2971455 GAGCGGGGAGGGGGGCAGGGTGG - Intronic
1005974929 6:30790720-30790742 GCCATGGGAGGGAGCCAGGAAGG - Intergenic
1006390939 6:33758081-33758103 GCCTGGAGAGCGCTCCAGGGAGG + Intergenic
1007363729 6:41375678-41375700 GCCCGGAGCGGGAGCCGGGGCGG + Intergenic
1007596464 6:43053887-43053909 GCCCTGGGAGAGCGCCGGGGCGG + Exonic
1007614436 6:43171853-43171875 CCCCGCGGTGGGCGCCGGGGTGG - Exonic
1008671133 6:53770041-53770063 GCCAGGGAAGGGCGCTAGAGAGG + Intergenic
1013122596 6:107154285-107154307 AGCCAGGGATGGCGCCAGGGCGG - Exonic
1014079554 6:117270918-117270940 GCCGGGCGCGGGCGCCGGGGCGG - Exonic
1014894805 6:126888828-126888850 GACCAGGGAAGGCACCAGGGTGG + Intergenic
1016971680 6:149769839-149769861 GCCTGGGGAGGCCAACAGGGAGG - Intronic
1017324702 6:153131420-153131442 GCCCGGGGAGGGGGCGGGGCCGG - Intergenic
1017709004 6:157148957-157148979 GCCCGGGGCGTGCTCCTGGGTGG - Intronic
1017719775 6:157236296-157236318 GCCTGGGTGGGCCGCCAGGGTGG - Intergenic
1018150286 6:160931185-160931207 GCCCGGGGCGGGGGCGCGGGTGG + Intergenic
1019153419 6:170023700-170023722 GCTCGGGGAGGGTGCTATGGAGG + Intergenic
1019188510 6:170235982-170236004 GCCAGGGGAGGGCCGCTGGGGGG + Intergenic
1019316383 7:388858-388880 TCCCGGGCAGGGAGCCAGGAGGG + Intergenic
1019346002 7:531197-531219 GCGGGGGGCGGGGGCCAGGGTGG + Intergenic
1019391046 7:787096-787118 GCCTGGGGGGGACGCCGGGGTGG + Intergenic
1019472815 7:1230228-1230250 GGCGGGGGAGGGCGCGGGGGAGG + Intergenic
1022096250 7:27143275-27143297 GCCGGGCGAGGGGGCCACGGCGG + Exonic
1022375555 7:29807575-29807597 GCCCGTGGCGGGCGCCGGGGCGG + Intronic
1024074475 7:45811591-45811613 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1024074806 7:45812949-45812971 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1025011461 7:55402302-55402324 GTCCGGGGAGGGAGGCGGGGAGG - Intronic
1025032474 7:55569214-55569236 GCCCAGGTAGGGCTTCAGGGAGG - Intronic
1025176350 7:56804261-56804283 GCCTGGAGAGGCCGCCAGGCGGG - Intergenic
1025695444 7:63772161-63772183 GCCTGGAGAGGCCGCCAGGCGGG + Intergenic
1026941249 7:74289352-74289374 GCCTGGGGCGGGCGGGAGGGGGG - Intergenic
1026968321 7:74453995-74454017 GCGCGGGGAGGGGGCGCGGGGGG - Exonic
1029211872 7:98916026-98916048 GCCAGGGGAGGGGGGCAGGGGGG - Intronic
1029226943 7:99035171-99035193 TCCCGGGGAGGGAGCTATGGGGG - Intronic
1029419615 7:100466085-100466107 GCCGGGGGTGGGAGCCACGGCGG + Intronic
1029620615 7:101688085-101688107 GCCCTGGGAGTGCAGCAGGGGGG - Intergenic
1030216074 7:107044855-107044877 TGCCGGGGAGGGGGCGAGGGCGG + Exonic
1030714237 7:112790054-112790076 GCCCTGGGAGGCCGACTGGGCGG + Intronic
1032051392 7:128652937-128652959 GCCCGGAGAGGACGCCCGGAGGG - Intergenic
1032051524 7:128653459-128653481 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1032076170 7:128837197-128837219 GCCCGTGGAGAACGCCCGGGAGG + Exonic
1032344311 7:131105792-131105814 GCCCGCGGAGGGCGCGCGAGGGG - Intergenic
1032525383 7:132575870-132575892 GCCCGGGGAGGAGGCCAGATAGG - Intronic
1033099932 7:138460940-138460962 GCCCGGGGAGAGGGCCAGGAGGG + Intronic
1033121870 7:138673822-138673844 GACCAGGCAGGGAGCCAGGGTGG + Intronic
1033660578 7:143399267-143399289 TCCCGGGGAGGGCCCCCAGGTGG - Exonic
1034306459 7:150048361-150048383 GCCCGGGACTGGCGCCTGGGTGG + Intergenic
1034546665 7:151794061-151794083 ACCAGGTGAGGGAGCCAGGGAGG - Intronic
1034898850 7:154895133-154895155 GACCAGGGAGAGGGCCAGGGTGG - Intergenic
1034957579 7:155344522-155344544 GTCCCGGGAGAGCCCCAGGGAGG - Intergenic
1034957625 7:155344643-155344665 ACCCCGGGAGAGCCCCAGGGAGG - Intergenic
1034988363 7:155531794-155531816 GCCTGGGCAGAGCTCCAGGGCGG + Intronic
1035130856 7:156651894-156651916 GCCGGGGGAGGGGACCACGGAGG - Intronic
1035130862 7:156651906-156651928 GCCCGGGGAGGGGCCGGGGGAGG - Intronic
1035224947 7:157427889-157427911 GCCAGGGGAGGAGGCCTGGGGGG + Intergenic
1035854265 8:2957449-2957471 GCCTCTGGAGGGAGCCAGGGAGG - Intronic
1036782699 8:11660403-11660425 GCCCAGGGTGGGTCCCAGGGAGG + Intergenic
1036806488 8:11837889-11837911 GCACAGGGAGGACTCCAGGGTGG + Intronic
1038296138 8:26291973-26291995 GGGCGGGGAGGGCTCCCGGGAGG + Intronic
1038963554 8:32548213-32548235 GCCAGGGGAGGGTGCGAAGGAGG + Intronic
1039880445 8:41622218-41622240 GCCCGGGGAGGGCTGCAGAGGGG + Exonic
1041739110 8:61139663-61139685 GCACGGGGAGGGCGCGAGAGAGG + Intronic
1043761601 8:84075727-84075749 GCCCAGGCAGGGCCCCCGGGAGG + Intergenic
1044924082 8:97195121-97195143 GACAGGGGAGGGAGACAGGGAGG - Intergenic
1045277465 8:100721285-100721307 GCCCGGGGAGGGGGGCGGGAGGG - Intronic
1046121161 8:109848739-109848761 TCCCAGGGAGTGCACCAGGGAGG - Intergenic
1048385052 8:133904376-133904398 GCCCAGGGAGGGAGTCAGTGTGG + Intergenic
1048981290 8:139704332-139704354 GCACGCGGAGGGAGCCCGGGAGG + Intergenic
1049065606 8:140311282-140311304 GCAGGGTGAGGCCGCCAGGGAGG + Exonic
1049189626 8:141279670-141279692 GCGCGGGGCGTGTGCCAGGGAGG - Intronic
1049194402 8:141307796-141307818 CCCCGGGGTGGGGGCCGGGGTGG + Intronic
1049297805 8:141852458-141852480 GCCCTGGGAGGCCCCGAGGGAGG + Intergenic
1049341378 8:142114403-142114425 CCCCAGGGAGGGCTGCAGGGAGG + Intergenic
1049745700 8:144262361-144262383 CCCTGGGGAGGGGGCCAGGCAGG + Intronic
1049747535 8:144269334-144269356 GCCAGGTGCGGGCGTCAGGGCGG + Intronic
1049788492 8:144462540-144462562 GCCCGGGGCGGCCGCCGGGCAGG - Intronic
1050090719 9:2015231-2015253 GCCCGCGGAGGAGGCGAGGGTGG + Exonic
1050537717 9:6645194-6645216 GCCCGGGCAGGGCGGAGGGGAGG + Intronic
1052816568 9:33106663-33106685 GCCCTGGGAGGGAGGCAGGGAGG + Intronic
1052896339 9:33750959-33750981 GCCCGGAGGGGGCCCCAGGTGGG - Intronic
1053050501 9:34957877-34957899 GCCCGGAGGGGGCGCCTTGGGGG - Intronic
1053603232 9:39631529-39631551 GCCCGATGAGGGCGCTATGGTGG + Intergenic
1053860867 9:42385250-42385272 GCCCGATGAGGGCGCTATGGTGG + Intergenic
1054250304 9:62710896-62710918 GCCCGATGAGGGCGCTATGGTGG - Intergenic
1054451152 9:65404211-65404233 GCCCTGGGAGGGTCCCAGTGTGG - Intergenic
1054564412 9:66745424-66745446 GCCCGATGAGGGCGCTATGGTGG - Intergenic
1057911579 9:99023902-99023924 GCCTGGAGAGGGAGGCAGGGAGG - Intronic
1058175994 9:101737622-101737644 GCCCGGGGAGGGCGCCAGGGCGG - Exonic
1059123351 9:111661782-111661804 GCCCGGACCGGGCGCCAGCGGGG + Intronic
1060105130 9:120868807-120868829 GCCCAAGCAGGGCCCCAGGGAGG - Intronic
1060402645 9:123357330-123357352 GGCTGGGGAGGGAGCCAAGGAGG + Intronic
1060813150 9:126621225-126621247 GCCAGGGGAGGGAGGAAGGGAGG + Intronic
1060885074 9:127145599-127145621 GGCCGGGGAGGGCTGCATGGAGG + Intronic
1061060875 9:128250046-128250068 GCCCGGTGGGGCGGCCAGGGCGG + Intronic
1061139111 9:128753631-128753653 GCCGGGGGAAGGGGCAAGGGTGG - Intronic
1061280898 9:129597286-129597308 CCCTGGGGAGGGCGTCAGGCGGG + Intergenic
1061289272 9:129641669-129641691 GGGCGGGGAGGGCCCGAGGGCGG - Intronic
1061290886 9:129649728-129649750 GGCCGGGGAGGGCGCCCAGTAGG + Intergenic
1061291838 9:129654902-129654924 GCCCGGGGAGGGAGGAAGGCAGG + Intergenic
1061472129 9:130835226-130835248 GCCCGGAGAGGGCGCCCGCCAGG - Intronic
1061828509 9:133275787-133275809 GCCCGGCGCGGGCGCCGGAGGGG - Intergenic
1061864331 9:133484798-133484820 CCCCGAGGAAGGCCCCAGGGGGG + Intergenic
1061904101 9:133687933-133687955 GGCGGGGGAGGCAGCCAGGGCGG - Intronic
1061976001 9:134068223-134068245 GCCCGGGGGGCGCGCGGGGGCGG + Intronic
1062250386 9:135590986-135591008 GCCTGGGGAGGTGGGCAGGGCGG - Intergenic
1062341298 9:136094966-136094988 GCCCGCGGAGGGGGGCCGGGCGG - Intronic
1062390380 9:136331414-136331436 GGCTGGGGAGGGGGCCAGGTGGG + Intronic
1062424044 9:136497924-136497946 CACCGGCGAGGGCACCAGGGAGG + Intronic
1062472574 9:136712847-136712869 GCCCGGGGTGGGCAGCGGGGAGG + Intronic
1062625992 9:137441701-137441723 GCCCGGGCCGGGCGGCACGGGGG - Intronic
1062629892 9:137458902-137458924 GCGCGGGGAGGGCGCCTCAGTGG + Intronic
1062653414 9:137590088-137590110 GCCCGGGATGGGCCCCAGCGGGG - Intronic
1062754220 9:138278850-138278872 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1203731933 Un_GL000216v2:98962-98984 GGCCGCGGGGGCCGCCAGGGAGG + Intergenic
1203577642 Un_KI270745v1:21085-21107 GCCCGGAGAGGACGCCCGGAGGG - Intergenic
1203577780 Un_KI270745v1:21607-21629 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1185449661 X:275583-275605 GCCCGGGGTGGGAGACAGCGGGG + Intergenic
1186454377 X:9699609-9699631 GCCTGGGGAGGGCTCCAGGCAGG + Intronic
1186760322 X:12716295-12716317 GCCCGGGGAGGCCCCCTGTGAGG + Exonic
1187464569 X:19515539-19515561 GGGCGGGGAGGGGGCCGGGGAGG + Intergenic
1189322856 X:40096986-40097008 GCCCCGCGTGGGCACCAGGGAGG - Intronic
1189324992 X:40106545-40106567 GCGCGGGGAGGGCGGGAGGCGGG - Intronic
1192175162 X:68880791-68880813 GCCGGGGGCAGGCGGCAGGGAGG - Intergenic
1192473703 X:71420876-71420898 GGCCGGGGAGGGGGCCCCGGGGG - Intronic
1192988778 X:76428415-76428437 ACCAGGGGTGGGCGGCAGGGAGG - Exonic
1198394006 X:136205282-136205304 AGCCGGGGAGGGGACCAGGGAGG + Intronic
1199772648 X:150984166-150984188 GCCCGGGGCGGGCGGCTCGGAGG + Intronic
1200053386 X:153446248-153446270 GCACGGGGAGGAAGCCAGAGTGG + Intronic
1200129517 X:153833345-153833367 GCCCTGGGAGAGCGTCCGGGAGG + Intergenic
1200218584 X:154379624-154379646 GCGCGGGGAGGGCAGCGGGGAGG - Intronic
1201918873 Y:19212719-19212741 GCCTGGGGAAGGGGCCTGGGTGG + Intergenic