ID: 1058176005

View in Genome Browser
Species Human (GRCh38)
Location 9:101737639-101737661
Sequence CCGGGCTTACGGGAGCCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058175987_1058176005 12 Left 1058175987 9:101737604-101737626 CCCGTGGCCACAGGGCCTCCGCC 0: 1
1: 0
2: 2
3: 43
4: 307
Right 1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 71
1058175994_1058176005 -6 Left 1058175994 9:101737622-101737644 CCGCCCTGGCGCCCTCCCCGGGC 0: 1
1: 0
2: 2
3: 48
4: 624
Right 1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 71
1058175988_1058176005 11 Left 1058175988 9:101737605-101737627 CCGTGGCCACAGGGCCTCCGCCC 0: 1
1: 0
2: 1
3: 55
4: 357
Right 1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 71
1058175995_1058176005 -9 Left 1058175995 9:101737625-101737647 CCCTGGCGCCCTCCCCGGGCTTA 0: 1
1: 0
2: 0
3: 1
4: 120
Right 1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 71
1058175996_1058176005 -10 Left 1058175996 9:101737626-101737648 CCTGGCGCCCTCCCCGGGCTTAC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 71
1058175990_1058176005 5 Left 1058175990 9:101737611-101737633 CCACAGGGCCTCCGCCCTGGCGC 0: 1
1: 0
2: 2
3: 56
4: 344
Right 1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 71
1058175991_1058176005 -3 Left 1058175991 9:101737619-101737641 CCTCCGCCCTGGCGCCCTCCCCG 0: 1
1: 0
2: 7
3: 56
4: 897
Right 1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058176005 Original CRISPR CCGGGCTTACGGGAGCCCGG CGG Exonic
900146994 1:1162749-1162771 CCCGGCCTATGGGAGCCCAGGGG + Intergenic
900344649 1:2205075-2205097 CGGGGCGTGGGGGAGCCCGGGGG - Intronic
910597203 1:88992809-88992831 CCGGGCTTGCGGGAACAAGGGGG + Exonic
915010273 1:152679008-152679030 CCTGGCTTATGGAAGCCTGGCGG + Intergenic
915933035 1:160071875-160071897 ACGGGCATAGGGGAGCCTGGGGG + Intergenic
921029803 1:211327074-211327096 CCGGGCTTGCGGGAGACCGGCGG + Intronic
922080849 1:222294451-222294473 CACAGCTTACGGGAGCCAGGTGG + Intergenic
922767393 1:228163132-228163154 CCAGGCTGACGTGAGCCCAGAGG + Intergenic
923391197 1:233515529-233515551 CCGGGCTCAGGGGAGGCCTGAGG - Intergenic
924772127 1:247087869-247087891 CCTGGCTGACAGGAGCCTGGTGG - Intergenic
1070777546 10:79118619-79118641 CCGGGCTGACTGGAGCCTAGTGG + Intronic
1072107892 10:92291308-92291330 CAGGGCCTGCGGGAGTCCGGCGG - Exonic
1081519027 11:43863347-43863369 CCTGTCTTTTGGGAGCCCGGGGG + Intergenic
1083233794 11:61339324-61339346 CCGGGCTGAAGGCATCCCGGTGG + Exonic
1083667986 11:64285686-64285708 CCGGGGTTACGGGAGGCGGCAGG - Intronic
1084010366 11:66345047-66345069 CAGCGCCTACGGGAGTCCGGCGG - Exonic
1093894702 12:24562795-24562817 GTGGGCTTGCGGGAGCTCGGGGG - Intergenic
1095888623 12:47215018-47215040 CTGGGATTACGGGAACCTGGGGG + Intronic
1096650374 12:53059427-53059449 CAGGGCTACCGGGAGCCCTGCGG + Exonic
1101411562 12:104472966-104472988 CTGGGAATACGGGAGCCCAGGGG + Intronic
1103764436 12:123271016-123271038 CCGGGCTGCCGGGGGCCCTGAGG - Intronic
1104942062 12:132399821-132399843 CCAGGCGTCCGGGAGCCCGCGGG - Intergenic
1121104682 14:91272665-91272687 CCGGCCTCCCCGGAGCCCGGCGG - Exonic
1122073834 14:99222793-99222815 CTGGGCTTACAGGAGCCTGGAGG - Intronic
1124952688 15:34338005-34338027 CGGGGCTTTCGGGCGCCCGCGGG - Intronic
1125534777 15:40436687-40436709 CTGGGCTCCCGGGAGCCTGGGGG + Intergenic
1126034796 15:44536566-44536588 CCGGGCTTCCGGGACCCCAGAGG - Intergenic
1128293559 15:66497753-66497775 CCGGGCCGACAGCAGCCCGGAGG - Exonic
1130979440 15:88803004-88803026 CAGGGCTCCCGGGCGCCCGGCGG - Intergenic
1131272855 15:90957366-90957388 CCGTGCCTACGTGAGCCCGCGGG + Exonic
1132547439 16:539873-539895 CCGGGCTTTTGGGGGCCGGGGGG + Intronic
1132931738 16:2462249-2462271 CTGGGCTTGTGGGAGCCCTGGGG + Intronic
1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG + Intronic
1142150453 16:88510308-88510330 CCTGGCTGAGGGGAGCCCGGTGG - Intronic
1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG + Intronic
1144756484 17:17682840-17682862 CCGGGCTGGCGGGGGCGCGGCGG + Intronic
1146646852 17:34581702-34581724 GCCGGCTTAGGCGAGCCCGGAGG + Intronic
1150815988 17:68392189-68392211 CGGGGCTTACTGGAGCCAGGAGG - Intronic
1151413398 17:73946106-73946128 CCTGCCTTAGGGGATCCCGGTGG - Intergenic
1152654642 17:81514098-81514120 CCGGGCTGACTGCAGCCCGCAGG - Intronic
1152698017 17:81805926-81805948 CTGGGCTGACCGGGGCCCGGGGG + Intronic
1157312997 18:46566296-46566318 CCAGGCTGACGGGCGCCTGGAGG - Intronic
1160452887 18:78978047-78978069 CCGGGCTTTGGGGCGCGCGGGGG - Intergenic
1161316144 19:3618592-3618614 CCGGCCTTATGGGAGCCACGGGG - Intronic
1163174533 19:15555184-15555206 AAGGGCTTAAGGGAGCCCTGGGG + Intergenic
1163587020 19:18169625-18169647 AGGGGCTTCCGGGACCCCGGGGG - Exonic
1165621436 19:37251875-37251897 CCACGTTTCCGGGAGCCCGGCGG + Intergenic
1166090299 19:40504029-40504051 CTGGGCTTGTGGGTGCCCGGCGG + Exonic
929542659 2:42834248-42834270 CCGGGCTTCCTGGGGCCTGGGGG + Intergenic
949004499 2:241637526-241637548 CCGGGCCGACGCGAGCCCCGGGG - Intronic
1169143513 20:3238737-3238759 CCGAGCTTTTGGGAGCCTGGCGG - Intronic
1180174814 21:46082378-46082400 CCGCCCTGACGGGAGCCCCGAGG - Intergenic
1184120033 22:42444145-42444167 CCGGGCTCTCGGCAGCCGGGCGG + Intergenic
1184640267 22:45866813-45866835 CCGCGCTTACGGGAGCGGCGGGG - Intergenic
952764442 3:36943056-36943078 CTGGGATTACGGGGGGCCGGGGG - Intronic
968230855 3:197003713-197003735 CCGGGAGGGCGGGAGCCCGGCGG - Intronic
973293499 4:48491272-48491294 CAGGGCACAGGGGAGCCCGGGGG + Intronic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
984823727 4:183906292-183906314 TCGGGCGTGCGGGAGGCCGGAGG - Exonic
985523295 5:389147-389169 CCTGGCGGAGGGGAGCCCGGGGG + Intronic
992774404 5:80077080-80077102 CCTGGCTGAAGGGAGCCCAGGGG - Intronic
994197501 5:96936202-96936224 CCGGGCTCTCCGGAGCCCTGAGG + Intronic
1010254501 6:73742498-73742520 CCAGGCTTCTGGGAGCCAGGAGG + Intronic
1015799263 6:137044459-137044481 CGGGGCTGCAGGGAGCCCGGGGG - Intronic
1019597883 7:1866748-1866770 ACGGGCTGACGGGAGCCCTGAGG + Intronic
1020130483 7:5556288-5556310 CCGGGCAGCGGGGAGCCCGGGGG + Intronic
1022114982 7:27253207-27253229 CCTGGCTCACTGGAGCCTGGAGG + Intergenic
1027121794 7:75527589-75527611 CCGGCCTCTCGGGAGCCGGGGGG - Intergenic
1029437314 7:100570451-100570473 CCGGGCTTCCGGGGGCCTCGGGG + Intergenic
1049585660 8:143431327-143431349 CCGTGCTTCCCGGTGCCCGGAGG - Intergenic
1057312091 9:93949030-93949052 CTGAGCTTCCCGGAGCCCGGGGG - Intergenic
1057490299 9:95515643-95515665 GCGGCCTCAGGGGAGCCCGGGGG - Intronic
1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG + Exonic
1062529175 9:136992417-136992439 CCGGGCGAGCGGGAACCCGGCGG - Exonic
1185457636 X:318757-318779 CCGGGCGTACGGCGGCCCGCAGG + Exonic
1189322320 X:40094479-40094501 CCGGGCTGGTGGGAGCGCGGGGG - Intronic
1193637441 X:83969436-83969458 CTGGGCTTCCTGGAGCCAGGAGG - Intergenic
1200233717 X:154458479-154458501 CCGGGGCTCCGGCAGCCCGGGGG + Intronic