ID: 1058176051

View in Genome Browser
Species Human (GRCh38)
Location 9:101737779-101737801
Sequence GCGGCTGGCCGCGCGGGGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 6, 2: 20, 3: 91, 4: 604}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058176033_1058176051 28 Left 1058176033 9:101737728-101737750 CCCTGGCTCCGGCTCATCCCTCT 0: 1
1: 0
2: 2
3: 51
4: 513
Right 1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG 0: 1
1: 6
2: 20
3: 91
4: 604
1058176039_1058176051 11 Left 1058176039 9:101737745-101737767 CCCTCTGGGCTCCTGCTCGGCTG 0: 1
1: 0
2: 1
3: 32
4: 317
Right 1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG 0: 1
1: 6
2: 20
3: 91
4: 604
1058176042_1058176051 0 Left 1058176042 9:101737756-101737778 CCTGCTCGGCTGTCGTCCGGAGC 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG 0: 1
1: 6
2: 20
3: 91
4: 604
1058176040_1058176051 10 Left 1058176040 9:101737746-101737768 CCTCTGGGCTCCTGCTCGGCTGT 0: 1
1: 0
2: 1
3: 23
4: 246
Right 1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG 0: 1
1: 6
2: 20
3: 91
4: 604
1058176037_1058176051 20 Left 1058176037 9:101737736-101737758 CCGGCTCATCCCTCTGGGCTCCT 0: 1
1: 0
2: 4
3: 56
4: 531
Right 1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG 0: 1
1: 6
2: 20
3: 91
4: 604
1058176034_1058176051 27 Left 1058176034 9:101737729-101737751 CCTGGCTCCGGCTCATCCCTCTG 0: 1
1: 0
2: 0
3: 32
4: 416
Right 1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG 0: 1
1: 6
2: 20
3: 91
4: 604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058176051 Original CRISPR GCGGCTGGCCGCGCGGGGGG CGG Exonic
900095958 1:940229-940251 TCTGCTGGCCGCGCGGGGGAGGG + Intronic
900113729 1:1020061-1020083 GCGGGCGGGCGGGCGGGGGGGGG - Intergenic
900113826 1:1020395-1020417 GCGGCAGGCGTCGCGAGGGGAGG - Intronic
900366665 1:2314519-2314541 GAGGCCGGCCTCGCGGGGGAAGG + Intergenic
900462997 1:2810242-2810264 GAGACTGGCTGCGGGGGGGGGGG + Intergenic
900629288 1:3625155-3625177 GCGGCGGCCCGGGCGGGGGGCGG + Exonic
900679786 1:3910493-3910515 GCGGCTGGCGCCGGGGGAGGTGG + Intergenic
901066589 1:6497331-6497353 GCCCCGTGCCGCGCGGGGGGCGG + Intronic
901229147 1:7632299-7632321 GCCGCTGGGGGCGCGGGGGGCGG - Intronic
901417743 1:9129138-9129160 GCGGCCGGACGCGGGCGGGGCGG - Exonic
901660303 1:10794889-10794911 GGGGCTGGCCGGGCGCGGGCGGG - Intronic
901673004 1:10867014-10867036 GGGGCTGGCCGAGCGGAGGGCGG - Intergenic
902214174 1:14924230-14924252 GCCGCCGGCCGGGCGGGAGGCGG + Intronic
902916762 1:19644351-19644373 GCGGCCGGCAGGGCGGGGGGCGG - Intronic
902920723 1:19664941-19664963 GCCGCGGGCCGGGCGGGCGGCGG - Intergenic
903349955 1:22711341-22711363 GCGGCTGCCCGAGCCGGGGGCGG - Intronic
903413784 1:23168148-23168170 GCCGCGGGCCGGGCGGGGAGGGG - Intronic
904160435 1:28518642-28518664 GCGGCCGCCCGGGCGGGGGATGG + Intronic
904181381 1:28668927-28668949 GCGGGCGGGCGCGCAGGGGGCGG + Intronic
904181429 1:28669081-28669103 GCGGCCGGCTGCGCTGGGGGCGG - Intronic
904417967 1:30374490-30374512 GGGGCTGGCCACGCGGGAGAGGG - Intergenic
904500073 1:30908384-30908406 CCGGCACCCCGCGCGGGGGGCGG + Intronic
904541935 1:31239367-31239389 GCGTGTGCCCGGGCGGGGGGTGG - Intronic
904720017 1:32500707-32500729 CCGGCCGGCCGGGCGCGGGGAGG - Intronic
904751073 1:32741782-32741804 GGGGCCGGCCGAGCGGCGGGCGG - Intergenic
904847438 1:33430821-33430843 GGGACGGGCCGCGCGGGGCGGGG - Intronic
905107742 1:35574201-35574223 GCGGGCGGCTGCGCGGGGCGCGG - Exonic
905308537 1:37034584-37034606 GCGGCGGGCGGCGCGGGAGGCGG - Intergenic
905449376 1:38046913-38046935 GCGGGCGGGCGCGCGGGGCGGGG - Intergenic
905531892 1:38686518-38686540 GCTGCTGGCCGGGGGAGGGGAGG + Intergenic
906204415 1:43979388-43979410 GCCGCTGACCGGGCGGCGGGAGG + Intronic
907430030 1:54406276-54406298 GCGGGCGGCCGTGCGGGCGGCGG - Exonic
907909726 1:58815415-58815437 GCGCCGGGCCGCGGGGGAGGCGG + Intergenic
908534874 1:65067566-65067588 GCGGCCGGGCGCGGGGGCGGCGG - Intergenic
910412649 1:86963770-86963792 GCAGCTGGCCGGGTGGGGGCTGG + Intronic
910935097 1:92480848-92480870 GCTGCCGGCGGCGCGGGGGCCGG - Exonic
911052399 1:93681803-93681825 GCTGCTGGCCGGGCGGGGGACGG - Intronic
912436887 1:109668294-109668316 GTGGCTGGGCGTGCGGGGTGGGG + Intronic
912471574 1:109910655-109910677 GGGGCTGGCCGGCCGGCGGGTGG + Exonic
912492709 1:110070726-110070748 GCGGCGCGCGCCGCGGGGGGCGG + Intronic
913962988 1:143353787-143353809 GGGGCCGGGCGCGCGGGCGGAGG + Intergenic
914057343 1:144179372-144179394 GGGGCCGGGCGCGCGGGCGGAGG + Intergenic
914121803 1:144786994-144787016 GGGGCCGGGCGCGCGGGCGGAGG - Intergenic
914231021 1:145764761-145764783 GCGGCTGGCTGGGCGGGGGCTGG - Intronic
914231370 1:145766780-145766802 GCGGCTGGCCGGGGGGGGGGGGG + Intronic
914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG + Exonic
914666937 1:149840273-149840295 CCGGATGGCCGCGCCGGGTGAGG + Exonic
914668830 1:149853517-149853539 CCGGATGGCCGCGCCGGGTGAGG - Exonic
914788020 1:150851201-150851223 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
914942647 1:152036616-152036638 GCCGCTCACCGCGCGGGGGGGGG - Intronic
915225029 1:154405662-154405684 CCTGCTGGCCGCGCCGGGAGCGG + Exonic
915571444 1:156747251-156747273 GCGGCGGGGCGGGGGGGGGGGGG - Intronic
917375554 1:174349031-174349053 GCGGCTGGCCGGGCGGGGGGGGG + Intronic
921944905 1:220879790-220879812 GTGGGTGGGCGCGCGGGGAGGGG - Exonic
922116436 1:222618261-222618283 GCGGCTGGCCTCGGGGCGGCTGG + Intronic
922518139 1:226223526-226223548 GCGTCTGGCGGGGCCGGGGGCGG + Intergenic
923299739 1:232630153-232630175 GCCGCTGGGCGGGCGGGCGGTGG - Intergenic
924414868 1:243849494-243849516 GAGGCTGTCTGCGCGTGGGGTGG - Intronic
1063671533 10:8103386-8103408 GAGGCTGGAGGCGGGGGGGGGGG + Intergenic
1064209032 10:13347973-13347995 GCGGCGGGCCCGGCGCGGGGGGG - Intronic
1064354333 10:14604116-14604138 GCGGGCGGCCGGGCGGGTGGGGG - Intronic
1065025099 10:21534102-21534124 GCGGCGAGCGGCGCGGGGGAGGG + Intergenic
1065025338 10:21534931-21534953 GCGGCGGGGCGCGGGGGGTGTGG + Intronic
1065099886 10:22321843-22321865 GGGGCGGGCGGCGCGGGGCGCGG - Intronic
1065881844 10:30043800-30043822 GCATCTGGCAGCCCGGGGGGTGG + Intronic
1066963645 10:42242475-42242497 GAGGCGGGGCGCGCGGGGAGGGG - Intergenic
1067034207 10:42900657-42900679 GCAGCTGGCCGGGCAGGGGCTGG - Intergenic
1067116113 10:43436847-43436869 GCGGCTGGGCGTCCGGGGGCGGG - Intronic
1067147575 10:43704293-43704315 GCTGCTGGCCGGGCGGAGGGAGG + Intergenic
1069034185 10:63630406-63630428 GGGGCTGGGCTGGCGGGGGGAGG + Intergenic
1069651652 10:70053568-70053590 GGGGCGGGCCGCGCCGGGGAAGG + Intronic
1069738389 10:70672448-70672470 GCGGCGGGACGGGCCGGGGGTGG - Intergenic
1070162546 10:73874655-73874677 GCCGGGGGCCGGGCGGGGGGGGG - Intergenic
1070768912 10:79070991-79071013 GCGGCTGGGCTGGCGGGGTGAGG + Intronic
1071579614 10:86756999-86757021 GCAGCTGGGCGCGCGGTGGCCGG + Intronic
1072253620 10:93600846-93600868 ACGGCGGGCCGCGGGGAGGGCGG + Intronic
1072453867 10:95560071-95560093 GCGGGGGGCTGGGCGGGGGGGGG + Intronic
1072591429 10:96832096-96832118 CCGGCGGGCGGCGCGCGGGGCGG + Intergenic
1073063646 10:100746115-100746137 GCTGCGGGGCGCGCGGGGGCGGG - Exonic
1073076420 10:100827844-100827866 GCGGCAGGCGGGGCTGGGGGCGG - Exonic
1073094085 10:100969487-100969509 GCGGCTGGAGGCGGGGCGGGGGG - Intronic
1073177699 10:101566516-101566538 GCGGCTGACAGCGGGAGGGGGGG - Intergenic
1073467796 10:103704421-103704443 GTGGCTGGCAGCACTGGGGGTGG + Intronic
1073991853 10:109270240-109270262 GCGGCTGCCAGAGCTGGGGGAGG - Intergenic
1074137955 10:110644241-110644263 CCGGCCGGCCACGCGGGGGCGGG - Intergenic
1074618654 10:115094104-115094126 GGGGGAGGCCGCGAGGGGGGCGG - Intronic
1075129579 10:119726362-119726384 GAGGCTGGCGGTGCGGGCGGGGG + Intronic
1075648006 10:124109147-124109169 GGGGCTGGGCGAGTGGGGGGGGG + Intergenic
1076374063 10:129971913-129971935 GTGGCAGGCGGCGCGGGGCGAGG - Intergenic
1076659769 10:132047867-132047889 GCGGGGGGCGGGGCGGGGGGTGG - Intergenic
1076683180 10:132185759-132185781 GCGGCAGGAGGCGGGGGGGGAGG + Intergenic
1076878763 10:133230131-133230153 GGGGCGGGGCGCGCGGGGCGGGG + Intergenic
1076885219 10:133259016-133259038 GCAGCTGGCCGTGCAGGGGGAGG + Intergenic
1076900772 10:133336372-133336394 GCCGCTGCCCGCACGGGGGTTGG - Intronic
1076993740 11:288818-288840 GCGGCCGGGGGCGCGGGCGGAGG + Intergenic
1077095721 11:798248-798270 GGTGCTGGCCGAGCGCGGGGCGG - Exonic
1077495324 11:2884382-2884404 GCGCCCGGCCGCGCCCGGGGAGG + Intronic
1079035137 11:17014262-17014284 GCGGGTGGGGGCGCGGGGGCGGG - Intronic
1079205640 11:18412246-18412268 GCGCCTGGGCCGGCGGGGGGCGG + Intergenic
1080503773 11:32893174-32893196 GCGGCGGGGGGCGCGGGCGGCGG - Exonic
1082002388 11:47400292-47400314 GGGGCGGGCGGCGCGGGGGAGGG - Intergenic
1082807492 11:57460195-57460217 GCGGCTGGGGGCGGGGGAGGGGG + Intergenic
1083033567 11:59615771-59615793 GCGGCTGGCCGGGCGGGGCGGGG - Exonic
1083599651 11:63938947-63938969 GCGGTTGGGCGGGGGGGGGGGGG + Intronic
1083920888 11:65780971-65780993 CGGGCTGGCGGCGCGGGGCGGGG + Intergenic
1083934013 11:65860954-65860976 GCGCCTGGCCGGGCAGGGGTAGG - Exonic
1083945119 11:65919205-65919227 GGGGCGGGCCGCGGGGGGCGGGG + Intergenic
1083970209 11:66070052-66070074 GCGGCCGGCCGTGGGCGGGGAGG + Intergenic
1084010865 11:66347675-66347697 GCGGCGGGCGGCGGGCGGGGCGG - Exonic
1084070100 11:66728262-66728284 GCGGCCGGGCGCACGGCGGGCGG + Intronic
1084128907 11:67118826-67118848 ACAGCTGGCCGCGAGGGGCGGGG + Intergenic
1084295768 11:68212971-68212993 GCGGCCGGGCGCGGGGGGCGGGG - Intronic
1084400802 11:68941813-68941835 GCGGCGGGCCGGGCGGGTGGGGG + Intergenic
1084588750 11:70078439-70078461 GCGGCGGGCGGAGCGGGAGGCGG + Exonic
1084888134 11:72223853-72223875 GGGGCGGGCGGCGCGGAGGGCGG + Intronic
1085157715 11:74311575-74311597 GCGGCTGGCGGCGCTGCTGGCGG - Exonic
1088648444 11:111937118-111937140 GCTGCGGCCCGGGCGGGGGGGGG + Intronic
1089262646 11:117232901-117232923 GTGGCTGGCAGCGGGGTGGGGGG + Intronic
1089520414 11:119059269-119059291 GCGGCTGGCCGTGCGGGGGCTGG + Intergenic
1089527631 11:119107621-119107643 GGGGCTGGGCGCGCGGGGTCGGG - Exonic
1089622276 11:119728875-119728897 GCAGCCGGGCGCGCCGGGGGTGG - Exonic
1091218619 11:133918221-133918243 TCGGCTGGGCGGGCGGGGGCGGG - Intronic
1091259876 11:134225367-134225389 CCGGCTGTCGGCGCTGGGGGAGG - Intronic
1092462337 12:8697838-8697860 GCGGCGCGGCGGGCGGGGGGCGG - Intronic
1094218509 12:27970347-27970369 GCGGGCGGGCGCGCGGGGGGCGG + Intronic
1094716910 12:33022779-33022801 GTGGCTGGCCGGGCGGGAGCTGG + Intergenic
1094716932 12:33022826-33022848 GTGGCTGGCCGGGCAGGGGCTGG + Intergenic
1096121541 12:49092181-49092203 AAGACTGGACGCGCGGGGGGAGG - Intronic
1096466488 12:51849522-51849544 GCGGGTGGCTGCGGGGGAGGAGG + Intergenic
1096668218 12:53181010-53181032 GCGGCGGGACGCGCGGGCAGGGG - Intronic
1097127987 12:56789485-56789507 GCGGCTGGCCGGGCGGGGGGGGG + Intergenic
1097155091 12:57006516-57006538 GCGGCGAGCCGCGCGGCGGATGG - Intergenic
1097164612 12:57076951-57076973 GGGGCGGGGCGGGCGGGGGGTGG + Intronic
1097191522 12:57221655-57221677 GCTGCTGTCGGCGCGGGGGCGGG - Intronic
1097284262 12:57865442-57865464 GCGGCTGGCCGGGCAAGGCGGGG + Intergenic
1098897810 12:76083965-76083987 GGGGGCGGCCGCGCGGGGAGGGG - Intronic
1099222887 12:79935149-79935171 ACGGGTGGCCGTGCTGGGGGCGG - Exonic
1100611587 12:96195057-96195079 GCTGCAGGCAGCGCGGGGAGCGG + Intronic
1101640132 12:106581637-106581659 CCGGCGGGCCGCGGCGGGGGCGG - Intronic
1102323394 12:111957582-111957604 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
1102681334 12:114692516-114692538 GCGGCGGGCTGCCCGGGTGGGGG + Intergenic
1103413015 12:120725971-120725993 GCGTCTGGCCCAGCGGGCGGAGG + Intronic
1103779428 12:123389194-123389216 GGGCCCGGCCGCGCGGGGGGCGG + Intronic
1103950692 12:124549489-124549511 GTGCCTGGCCTCGCGGGTGGGGG - Intronic
1104444719 12:128823883-128823905 GCTGCTGGGCGCGCGGCGGGCGG - Exonic
1104676528 12:130715346-130715368 GCGGCTGGCCGGAGGGAGGGAGG - Intronic
1104977768 12:132559951-132559973 GGAGCTGGGCGCGCGGGAGGCGG - Intronic
1105472052 13:20703714-20703736 GCCGGGGGCCGCACGGGGGGCGG - Intronic
1106109046 13:26760834-26760856 GCGGCCGGGCGCGCGCGGGGCGG - Intergenic
1106184883 13:27400670-27400692 GCGGCTGGCGGGGAGGGGAGTGG - Intergenic
1106517132 13:30465293-30465315 GCGGCCAGCCGGGCGGGCGGCGG - Intronic
1108541541 13:51451854-51451876 GCGGCTGGGAGCGCAGCGGGTGG + Intronic
1110569861 13:76991925-76991947 GCCGCGGGCCGGGCGCGGGGAGG + Exonic
1110630154 13:77698109-77698131 GCGGGGGGCGGCGCGGCGGGCGG - Intronic
1114677511 14:24453617-24453639 GCGGCAGCCCGGGCTGGGGGAGG - Intergenic
1115119847 14:29927095-29927117 GCGGCTGGCCCCGCCGCGGCTGG - Intronic
1115474571 14:33800612-33800634 GGGGGCGGCGGCGCGGGGGGCGG + Exonic
1117424467 14:55580390-55580412 GCGGCGGGGAGCGCGGGGGGAGG + Intronic
1117803984 14:59470944-59470966 GTGGCTGGGGGCGGGGGGGGGGG + Intronic
1118797041 14:69153058-69153080 CCGGATCGCAGCGCGGGGGGAGG - Exonic
1119383094 14:74240834-74240856 GGGGCTGGCCGCGCAGGGCAGGG + Intronic
1119485507 14:74984397-74984419 GGGGCTGGGCGAGCGGGGAGAGG + Intergenic
1119702089 14:76762182-76762204 GCAGCTGGCCGGGAGCGGGGAGG - Exonic
1119722018 14:76898114-76898136 GCGGCTGGCGGGGCGGGGGCTGG + Intergenic
1119835777 14:77747757-77747779 GCGGCTGGCCAGGCAGGGGCTGG - Intronic
1120406521 14:84099487-84099509 GCGGCTGGCCGGGCGGGGGCTGG + Intergenic
1120406544 14:84099533-84099555 GCGGCTGGCCGGGCGGGGGCTGG + Intergenic
1121074934 14:91060252-91060274 GCGGGTGCCCGCGCGGGGCTGGG - Intronic
1121417402 14:93788723-93788745 GCGCCTAGCCGCGCGCGGGGCGG + Intergenic
1122143375 14:99675235-99675257 GCGGCGGGCGGCGGCGGGGGCGG + Exonic
1122221252 14:100240105-100240127 GCGGCAGGCCGCGGGGGGGAGGG + Intronic
1122444964 14:101761615-101761637 GCGGCCGGCCGGGGGGTGGGAGG + Intergenic
1122470754 14:101964501-101964523 GCGGCCGGCGGGGCGGGGCGGGG + Intergenic
1122550159 14:102545065-102545087 CCGGCTCCCCGGGCGGGGGGTGG + Intergenic
1124436883 15:29657470-29657492 TCGGCTGGGGGGGCGGGGGGGGG + Intergenic
1124500841 15:30225401-30225423 GCTGCTGGCCGGGCGTGTGGAGG - Intergenic
1124500870 15:30225494-30225516 GCCGCTGGCGGCGCCGGGTGAGG - Intergenic
1124641244 15:31397863-31397885 GGGGGTGGCGGCGGGGGGGGTGG + Intronic
1124742700 15:32313173-32313195 GCCGCTGGCGGCGCCGGGTGAGG + Intergenic
1124742730 15:32313266-32313288 GCTGCTGGCCGGGCGTGTGGAGG + Intergenic
1125524781 15:40368061-40368083 GCGGCTGTGCGCGCCGGGCGCGG + Exonic
1125608070 15:40953403-40953425 GCAGCTGGCCGCGGTGGGCGTGG + Exonic
1126348356 15:47718826-47718848 GCGGCTGCCGGCGCGAGCGGCGG - Exonic
1126823671 15:52528931-52528953 GGGGAGGGCCGCGCGGGGCGGGG + Exonic
1127142609 15:55993326-55993348 GCGGCTCGGCGCGCGGGCGCTGG - Intronic
1127644687 15:60947023-60947045 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
1127644711 15:60947070-60947092 GCGGCTGGCCGGTCGGGGGCTGG - Intronic
1128056388 15:64702923-64702945 GCGGATGGCCCCGCTGCGGGGGG + Intronic
1128321994 15:66701083-66701105 GCGGGGCGCCGCGCCGGGGGTGG + Intergenic
1129162246 15:73753232-73753254 GCGGCGGGGCGGGCCGGGGGCGG - Intergenic
1129220754 15:74130346-74130368 GCGGCTAGCAGCGGGGGGTGCGG + Intronic
1129710645 15:77818962-77818984 GCGGCGGGCCGGGAGGGGTGGGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1131136212 15:89937983-89938005 CTGGCTGGCCGGGCGGGGGGGGG - Intergenic
1131174421 15:90201231-90201253 GGCGCTGGCAGCGCGAGGGGCGG - Intronic
1131200088 15:90388536-90388558 GCGGCGGGCGGCGGGCGGGGAGG + Intronic
1131735425 15:95326768-95326790 GCGGCTGGCAGCCAGGGGGGCGG - Intergenic
1131828449 15:96338872-96338894 TTAGCTGGCCGGGCGGGGGGTGG + Exonic
1132055720 15:98649173-98649195 GGCCCTGGCCGCGCGGGAGGCGG - Exonic
1132275388 15:100559081-100559103 GCGCCGGGCCGCGCGCTGGGAGG - Intergenic
1132314381 15:100879673-100879695 GCGGCGGGCGGGGCGGGGTGAGG + Exonic
1132580143 16:680864-680886 GAGGCCGGCCGGGTGGGGGGAGG + Intronic
1132663811 16:1072844-1072866 GGGGGTGCCCGCGCGGGAGGGGG - Intergenic
1133040606 16:3058347-3058369 GCGGCGGGGCGCGCTGGGGCCGG + Intronic
1133212687 16:4272173-4272195 GCGGCTCCCGGCGCGGGGTGGGG - Intronic
1133315981 16:4884358-4884380 GCGGCTGGCAGCGCTGGAGCAGG - Exonic
1134290780 16:12901798-12901820 GCGCCCGGCCGGGCGGGGGGAGG - Exonic
1135407288 16:22207201-22207223 GCCGGTGGCCGCGCGGGGGTGGG + Intronic
1135607291 16:23835870-23835892 GCAGCTGGCAGCGCTGGGCGGGG + Intergenic
1136365150 16:29806329-29806351 CCGGCTGGGCGCGCGCGCGGCGG + Intronic
1136365377 16:29806910-29806932 GCGGCGGCCCGGGCTGGGGGGGG + Intronic
1136458497 16:30395623-30395645 GCGGCCGGCGGCGCGGGCAGGGG + Intronic
1136913015 16:34159613-34159635 GGGGCTGGCCGCGATGGCGGAGG + Intergenic
1136993316 16:35170350-35170372 GCGGCAGGCCGGGCGGGTTGCGG - Intergenic
1138178740 16:54928885-54928907 GCGGCGGGCGGAGCCGGGGGCGG + Intergenic
1138467192 16:57200938-57200960 GCGGCTGGCCGGGGGGGGGGGGG + Intronic
1138619035 16:58197573-58197595 GGGGGTGGCCGGGCGGGGGCAGG + Intronic
1139547002 16:67654071-67654093 GCTGCCGGCCGGGGGGGGGGGGG + Intronic
1139954361 16:70686136-70686158 AGGGCGGGCCGCGCGGGAGGGGG + Intergenic
1140078630 16:71723948-71723970 CCGGCGGGCCGCGGGGGGCGGGG - Intronic
1140442573 16:74999083-74999105 GCGGCTGGCGGGGCCGGCGGCGG + Exonic
1141184706 16:81779193-81779215 CCGGCTGGGCGCGCCTGGGGCGG + Intronic
1141682576 16:85553223-85553245 CCGGCGGGGCGCGCGGGGTGGGG + Intergenic
1141830128 16:86505755-86505777 GCGGCTGCCCTCGCGGTGGGTGG + Intergenic
1141989516 16:87602317-87602339 GGGGCTGGGGGCGCGGAGGGCGG + Intronic
1141989617 16:87602599-87602621 GCCGCGGGCCGGGCGCGGGGCGG - Intronic
1141989640 16:87602665-87602687 GCGGCGGGGCCCGCGGGCGGCGG - Intronic
1142136320 16:88453481-88453503 GGGGCTGGGCGCGCGGGCTGGGG + Exonic
1142467391 17:144070-144092 GCGGCGGGCGGGGCGGCGGGCGG + Intergenic
1142467397 17:144082-144104 GCGGCGGGCGGGGCGGCGGGCGG + Intergenic
1142627784 17:1203387-1203409 GGGGCGGGGCCCGCGGGGGGCGG + Intronic
1142757622 17:2025193-2025215 GCGGCCGGCCGGCCAGGGGGCGG - Exonic
1142856751 17:2734978-2735000 GCGGCTGGACGGGTGGGGAGAGG - Intergenic
1143443921 17:6996231-6996253 GCTGCGGCCCGCGCGGGGCGAGG + Exonic
1143483403 17:7239472-7239494 GCGGCCGGCGGCGCGGGGGGAGG - Exonic
1144656822 17:17042410-17042432 GCGGGCGGCCGGGCGCGGGGAGG - Intergenic
1144767006 17:17738379-17738401 GCGGCTGGCCTGGCGGGGCGGGG + Intronic
1144848278 17:18231269-18231291 GGGGCTGGCCTGGCAGGGGGAGG - Intronic
1144953024 17:19004206-19004228 AGGGCGGGCCGCGCGGGGAGGGG + Intronic
1145205920 17:20984802-20984824 GTGGCTGGCCGGGCTGAGGGCGG - Intergenic
1145862985 17:28224288-28224310 GCGGCTGGCCGGGCGGGGGGCGG - Intergenic
1146057790 17:29589698-29589720 GCGGCCGGCAGCGCGCGGCGGGG - Intronic
1146062008 17:29612633-29612655 GAGGCTGGGGGCGCGGGGGCTGG - Exonic
1146398550 17:32486943-32486965 GCGGGCGGCCGAGCGGGGGGCGG + Exonic
1147150222 17:38510030-38510052 GCGGCGGGAGGCGCGGGGGCTGG + Exonic
1147184234 17:38705134-38705156 GCGGCTGGCGGCGGGCGGGCCGG + Intergenic
1147429445 17:40362713-40362735 GGGGCAGGCCGGGCTGGGGGCGG - Intronic
1147508702 17:41046919-41046941 TCGGCTGGCCGCAGGGGGGCCGG + Exonic
1147510542 17:41065497-41065519 TCGGCTGGCCGCAGGGGGGCCGG + Exonic
1147617014 17:41835818-41835840 GGGGCCGGCCGGGCTGGGGGCGG - Intronic
1147723613 17:42553467-42553489 GCCGCTGGAGGCGCTGGGGGAGG + Exonic
1148113422 17:45161027-45161049 GAGGCTGGCGCCGCGGGGGAGGG - Intronic
1148183097 17:45620659-45620681 GGGCCTGGCTGCCCGGGGGGCGG + Intergenic
1148265754 17:46225032-46225054 GGGCCTGGCTGCCCGGGGGGCGG - Intronic
1148299522 17:46534806-46534828 GCGGCTGGCCAGGCGGGGGCTGG + Intronic
1148674645 17:49438407-49438429 GCAGCTGGCCGAGCTGTGGGAGG - Intronic
1148699400 17:49578742-49578764 GCTGCTGGCCCCGCCTGGGGAGG + Exonic
1148780239 17:50117416-50117438 GCGGCTCTGCGCGCGGGTGGCGG + Exonic
1149296279 17:55265039-55265061 GCGGCCGCCGGCGCGGGGAGGGG + Exonic
1149610510 17:57955271-57955293 GCCGCGGGCCGGGCGGGGGAGGG + Exonic
1150150941 17:62808352-62808374 GCACCTGGTCGCGCGGGGGCGGG - Intergenic
1150161155 17:62899226-62899248 GCCGCTGGCTGGGCGGGGTGTGG + Intergenic
1150402992 17:64874482-64874504 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
1150562209 17:66303303-66303325 GCGGGTGGGCGCGCCCGGGGAGG - Intronic
1150624787 17:66835010-66835032 GCAGCTGGCAGCGCCGGGGTGGG + Intergenic
1150638592 17:66933883-66933905 ACGGCTGGCGGGGGGGGGGGGGG + Intergenic
1151490716 17:74431154-74431176 GCTGCTGGCCTCGCGGGGGGTGG - Exonic
1151725050 17:75878661-75878683 GGGGCGGGCCGAGCTGGGGGCGG - Intergenic
1151954313 17:77373056-77373078 GCAGCGGGGCGCCCGGGGGGAGG + Intronic
1152224374 17:79085888-79085910 ACGGCTGGACGCCCGGGGGCGGG - Intronic
1152581144 17:81166110-81166132 GCGGCGGGGGGCGCGGGGCGCGG - Intergenic
1152584050 17:81181344-81181366 GCGGGGGGCCGCGCCGGGCGGGG - Intergenic
1152648561 17:81481582-81481604 GCGGCGGGCCGGCCCGGGGGAGG + Intergenic
1152718552 17:81911408-81911430 GCGCCTGGCGGGGCGGGCGGCGG - Intronic
1152728668 17:81959741-81959763 GGAGCTGGGCGCGCGGGGCGCGG - Intronic
1152744164 17:82031549-82031571 GCGCCCGGCCGCGCGGCTGGCGG - Intergenic
1152782095 17:82231138-82231160 GCGGCTGGCGGGGCGGGGCCGGG + Intronic
1153480690 18:5543661-5543683 GCGGCGGGCGGAGCGGGCGGGGG + Intronic
1154241530 18:12657835-12657857 GCGGCTGGCCCGGCGGGCGGCGG - Exonic
1154266662 18:12884360-12884382 GGGGCGGGGCGCTCGGGGGGCGG + Intronic
1154367704 18:13726485-13726507 GCGGCTGGCGGGGCCGGGGGCGG - Exonic
1155508007 18:26549880-26549902 GAGCCTGGGCGCGCCGGGGGCGG - Intronic
1156325537 18:36071510-36071532 GGGGCTGGGGGCGGGGGGGGGGG + Intergenic
1156411128 18:36829023-36829045 GGGGCCGGCCGCGCAGGCGGGGG + Intronic
1156488997 18:37485434-37485456 GCGGCGCGGCGCGCGGGGAGAGG - Intronic
1157610123 18:48950674-48950696 GGCGCGGGCCGCGCGGGGTGGGG - Exonic
1157610317 18:48951534-48951556 GGGGCTGACAGCGCGGGGGAGGG + Intergenic
1158259027 18:55587859-55587881 GGGGCTGGCGGCGAGGGGGAGGG + Intronic
1159511406 18:69401356-69401378 CCGGCTGGCTGCCTGGGGGGGGG + Intronic
1159586597 18:70288834-70288856 GCCGGGGGCCGCGCGGGGCGGGG - Intergenic
1160156967 18:76441776-76441798 GCAGCTGGCCACGCGGGGTAAGG - Exonic
1160206416 18:76837131-76837153 GAGGCTTGCGGGGCGGGGGGGGG - Intronic
1160453066 18:78978906-78978928 GCGCCTGTGCGCGCGGGGCGAGG + Intergenic
1160453544 18:78980488-78980510 GCGGCCGGCCTGGCGCGGGGCGG - Intronic
1160543308 18:79637606-79637628 GCGGCTTCCAGCGCGGGAGGAGG - Intergenic
1160725498 19:616311-616333 GCTGCTGGCCGGGCGTGTGGAGG - Exonic
1160745329 19:708774-708796 GGGGCGGGGCGCGCGGGGCGGGG + Intergenic
1160745373 19:708926-708948 GCGGCGGCGGGCGCGGGGGGTGG - Intergenic
1160765608 19:806233-806255 GCGGGTGGCTGTGCGGGGGTCGG + Intronic
1160897009 19:1407832-1407854 GCGGCGGGCCGGGCTCGGGGCGG - Intronic
1160930624 19:1568106-1568128 GCGGAGGGCGGCGCGGGCGGCGG - Intergenic
1161014919 19:1978755-1978777 GCGGCGGGCGGGGCGGGGCGGGG + Intronic
1161015394 19:1980561-1980583 GCGGCTGGCGGGGCGGGGCCAGG - Exonic
1161029425 19:2050911-2050933 GCGGGCGGCCGGGCGGGGGGCGG + Exonic
1161210330 19:3062356-3062378 GGGGCCGGGCGCGCGGGGAGGGG - Intronic
1161249007 19:3270608-3270630 GCGGCCGGGCGGGCGGGCGGCGG + Intronic
1161289086 19:3483262-3483284 GCTGCTGGCCGCGCTGGTGGTGG - Intergenic
1161428176 19:4216062-4216084 GCGGCTGGGAGTGCGTGGGGAGG - Intronic
1161471257 19:4457702-4457724 GCGGCTGGCCCGGCGGCGGGGGG + Exonic
1161471267 19:4457717-4457739 GCGGGGGGCCGCGGGGGCGGGGG + Exonic
1161595407 19:5148731-5148753 GAGCCTGGCCACGCCGGGGGTGG + Intronic
1162255211 19:9483634-9483656 GCGGCTGGCCGGCGGGGGGCTGG - Intronic
1162403753 19:10461418-10461440 GAGGCTGGCCGGGCTGGGGAGGG + Intronic
1162778755 19:12995916-12995938 CCGGCCGGCGGCGCGGGCGGAGG + Intronic
1162940449 19:14006060-14006082 GTGGCTGGCCGGGCCGGGGTGGG - Intronic
1162951765 19:14075204-14075226 GTGTCTGGCCGTGCCGGGGGAGG - Intergenic
1163118370 19:15201067-15201089 CCGGGAGGCCGGGCGGGGGGCGG - Intergenic
1163573880 19:18099257-18099279 GTCTCTGGCCGCGCGGGGGTGGG + Intronic
1163655662 19:18543520-18543542 GCGGCTGGGGGCGGGGAGGGGGG - Exonic
1163996110 19:21048792-21048814 GCGGCTGGCCGGGCGGGTGCTGG + Intronic
1164046937 19:21551313-21551335 GCGGCTGGCTGGGCGGGGGCTGG + Intronic
1164046960 19:21551360-21551382 GTGGCTGGCCGGGCGGGGGCTGG + Intronic
1164065049 19:21708076-21708098 GCGGCTGGCCGGCCAGGGGCTGG - Intergenic
1164105330 19:22105333-22105355 GCGGCTGGCCGAGCGGGGGCTGG - Intergenic
1164168084 19:22700448-22700470 GCGGCTGGCCGGGTGGGGACTGG + Intergenic
1164244730 19:23419530-23419552 GCGGCTGGCCGGGCGGGGGCTGG - Intergenic
1164244753 19:23419576-23419598 GCGGCTGGCCGGGCAGGGGCTGG - Intergenic
1164301289 19:23964468-23964490 GTTGCTGGCCGGGCGGGGGCTGG - Intergenic
1165089263 19:33374034-33374056 GAGGCTGGAGGCGCGGGCGGCGG + Intronic
1165349826 19:35269375-35269397 GCAGCTGGGCGCGGGGGCGGGGG + Intronic
1165431445 19:35775724-35775746 GGGGCGGGGCGCGCGGGGCGGGG - Intronic
1165742802 19:38213610-38213632 GCAGCAGGGCACGCGGGGGGCGG + Intronic
1165851234 19:38851411-38851433 GGGGCTGCCCGCGCAGGGTGTGG + Intronic
1165924939 19:39320938-39320960 GCGGCGGGCGGCGCGGAGGGCGG - Intergenic
1166359092 19:42244861-42244883 GCGCCTAGCCGCGCGTGGTGCGG - Intronic
1166706140 19:44908986-44909008 GCGGCTGCGCGCGCGGATGGAGG + Exonic
1166798946 19:45444265-45444287 GCGGCTGGCTGGGGGAGGGGGGG - Intronic
1166857990 19:45792731-45792753 GCGGCGGGCGGCGCGGAGGGCGG - Exonic
1167293678 19:48637508-48637530 GGGGCTGGACGCGCCGGGCGGGG - Intergenic
1167297779 19:48661970-48661992 GCGGCTGGCCGTGCGCGTGCTGG - Exonic
1167466109 19:49651785-49651807 GCGGCGGGCGGCGCGGGAGCCGG - Exonic
1167522067 19:49961006-49961028 GCTGCTGCCCGTGCTGGGGGCGG - Exonic
1167523315 19:49969719-49969741 GCTGCTGCCCGTGCTGGGGGCGG + Intergenic
1168076342 19:53982586-53982608 GCGGCCGGGGGCGCCGGGGGCGG + Exonic
1168100862 19:54140245-54140267 GCGGGTGGCGGGGTGGGGGGAGG - Intronic
1168309353 19:55452705-55452727 GGGGGTGGCGGCGTGGGGGGCGG + Intergenic
1168536063 19:57171998-57172020 GCCGCGGGCCGCGAGGGGGGCGG + Intergenic
1168717692 19:58538862-58538884 GAGGCTGGCCCCGGGGGGGTGGG - Intronic
1168721809 19:58558504-58558526 GCGGCAGGCCGGGCGGGTGGCGG - Exonic
925101482 2:1250151-1250173 GAGGCTGGCAGCCCTGGGGGAGG - Intronic
925609483 2:5691901-5691923 GCGGCTGACCGCGAGCCGGGCGG + Intergenic
925984729 2:9206725-9206747 GCGGCCGGCCGGGCGTGGGGCGG - Intergenic
926089984 2:10043498-10043520 GCGGCTGGCGGGGCGGGGCGCGG - Intronic
926205618 2:10832915-10832937 GTGGCTGGGGGGGCGGGGGGTGG - Intronic
927156681 2:20224892-20224914 GCGGCAGGCTGCGCGGGTCGCGG + Exonic
927486442 2:23491539-23491561 GCTGCTGGCCCAGCGGGGGAAGG - Intronic
927881563 2:26693162-26693184 ACGGCTCGCCGGGCGGGGGGCGG + Intronic
928511969 2:32010681-32010703 GCGGGGAGCCCCGCGGGGGGTGG - Intronic
928998739 2:37324837-37324859 GGGCCGGGGCGCGCGGGGGGCGG + Intergenic
929218131 2:39437182-39437204 GCGGCGGGCCGCGGGGGGCGGGG - Exonic
929452830 2:42048171-42048193 GGGGCCGGCCGGCCGGGGGGAGG + Exonic
929501416 2:42494082-42494104 GCGGAGGGCGGCGCGGAGGGAGG - Exonic
929857931 2:45651558-45651580 GCCTCTGACCGCGCGGGGCGGGG - Intronic
930244874 2:48973363-48973385 GCGGCTGACTGCGGGGCGGGGGG - Intronic
931355847 2:61537497-61537519 GCGGCCGGGCGGGCGGGAGGAGG - Intronic
931479997 2:62630547-62630569 GCGGCTGGCTGGCCGGGGGCTGG - Intergenic
932231529 2:70087665-70087687 GCGGCTGGCGGGGGGAGGGGAGG - Exonic
932575752 2:72961529-72961551 GGGGCTGGACGCGTGGCGGGTGG - Intronic
932798125 2:74715474-74715496 GCGGCTGGCAGGGCCTGGGGCGG + Intergenic
933278232 2:80304649-80304671 GCGGACGGCGGCGCGGGGAGCGG + Exonic
934277983 2:91589059-91589081 GGGGCCGGGCGCGCGGGCGGAGG + Intergenic
934321362 2:91974675-91974697 GAGGCAGGGCGCGCGGGGAGGGG + Intergenic
934588593 2:95526939-95526961 GAGGCTGGCCGTCCGCGGGGCGG - Intergenic
934670316 2:96208436-96208458 GCGGCGGGCCCTGCGGGAGGCGG - Exonic
935112160 2:100104287-100104309 GCGGCCGGCCGCCGTGGGGGTGG - Intronic
935592363 2:104855074-104855096 GGGGCTCGCCGGGCGGGGCGGGG - Intergenic
935592550 2:104855592-104855614 GGGGCTGGCGGCGGCGGGGGTGG + Exonic
935692709 2:105745145-105745167 GCGGCTAGGCGGGCGTGGGGCGG + Intronic
936122815 2:109760864-109760886 GCGGCCGGCCGCCGTGGGGGTGG + Intergenic
936221874 2:110610600-110610622 GCGGCCGGCCGCCGTGGGGGTGG - Intergenic
936747981 2:115603324-115603346 GGGGGTGGCGGGGCGGGGGGTGG - Intronic
938931223 2:136088300-136088322 CCGGCTGGCCGCTCGGGGTGCGG + Intergenic
939969658 2:148644960-148644982 GCGGCGGGGCGGGCGGGGAGGGG - Intronic
942346126 2:175004927-175004949 GCGCCTGGACTCGCGGGCGGCGG - Exonic
942890482 2:180980988-180981010 CCGGGGGGCCGCGTGGGGGGCGG + Intronic
943005822 2:182386760-182386782 GCGGCTGGCCGGGTGGGGGCTGG - Intronic
944244290 2:197516020-197516042 ACGGCAGCCTGCGCGGGGGGCGG - Exonic
945225850 2:207530398-207530420 GCGGCGGGCGGCGGGCGGGGTGG + Intronic
945833125 2:214809703-214809725 GGGGCGGGGCGCGCGGGGAGGGG + Exonic
946182510 2:217957123-217957145 GGGGCGGGCCGCCCTGGGGGTGG - Intronic
946240149 2:218348962-218348984 GCGGCTGGCCGGCCGGGGGCTGG + Intergenic
946326081 2:218985303-218985325 GCCCCGGGCCGCGCGGGGGCCGG - Exonic
946340193 2:219061277-219061299 GCGGCCGGACGCGAGGGGCGGGG + Intergenic
946358878 2:219207047-219207069 GGGGCGGAGCGCGCGGGGGGCGG + Intronic
946662792 2:222019141-222019163 GCAGCTGGGTGGGCGGGGGGGGG + Intergenic
947399134 2:229714608-229714630 GGGGCGGGGCGAGCGGGGGGCGG + Intergenic
947591491 2:231388605-231388627 CAGGCTGGCCGCCCGGTGGGCGG + Intergenic
947641050 2:231708090-231708112 ACGGCTGCCAGCGCGGGGGAGGG - Intronic
947859631 2:233349302-233349324 GCAGCTGGCCACGCTGGGGAGGG + Intergenic
948874633 2:240820093-240820115 GCGGGAGGCCGGGCGGGCGGCGG + Intronic
948874727 2:240820428-240820450 GCGGCGGGCCCCGCGGAGGGTGG + Intergenic
1169164209 20:3408001-3408023 GGGGCTGGTCGGGCGGGGCGGGG - Intergenic
1169171747 20:3471022-3471044 TCGCCTGGCCGTGCGGGGCGGGG - Exonic
1169215934 20:3794910-3794932 GCGGGTGGTGGTGCGGGGGGCGG - Intronic
1170156614 20:13274668-13274690 GGGGCCGGGCGCGGGGGGGGCGG - Intronic
1171012132 20:21514591-21514613 GGGGGTGGGCGCGCGGGGGCGGG - Intergenic
1171217350 20:23362095-23362117 GGGGCCGGCCGCGGGAGGGGAGG + Intergenic
1171463683 20:25312969-25312991 GTGGCTGGCCGGTCGGGGGCTGG - Intronic
1172661746 20:36573476-36573498 ACGGCCCGCCCCGCGGGGGGTGG + Exonic
1172944064 20:38674481-38674503 GGGGCTTGACGCGCGGGGGCGGG - Intergenic
1173649103 20:44651741-44651763 GCGGCGGGCGGGGCGGGAGGCGG - Exonic
1175340937 20:58228605-58228627 GCGGCGGGCGGCGGCGGGGGCGG - Exonic
1175358548 20:58389304-58389326 CCGGGTGGGCGCGCTGGGGGGGG - Exonic
1175685212 20:61023813-61023835 GCGAGTGGCCGCGTGGGTGGGGG - Intergenic
1175685238 20:61023898-61023920 GCGAGTGGCCGCGTGGGCGGAGG - Intergenic
1175685247 20:61023928-61023950 GCGAGTGGCCGCGTGGGTGGGGG - Intergenic
1175685256 20:61023956-61023978 GCGAGTGGCCGCGTGGGTGGGGG - Intergenic
1175685266 20:61023985-61024007 GCGAGTGGCCGCGTGGGTGGGGG - Intergenic
1175685287 20:61024062-61024084 GCGAGTGGCCGCGTGGGCGGGGG - Intergenic
1175685307 20:61024120-61024142 GCGAGTGGCCGCGTGGGCGGGGG - Intergenic
1175750719 20:61495388-61495410 GGGGCTGGCGGCGGGGGGAGGGG - Intronic
1175847399 20:62065888-62065910 GGCGCTGGGCGGGCGGGGGGCGG + Intergenic
1175847466 20:62066094-62066116 GCGGCGGGAAGCGCGGGGGCTGG + Intergenic
1175856416 20:62122994-62123016 GCGGCCGGCTACGCTGGGGGAGG - Intronic
1176178684 20:63739923-63739945 CCGGCCGGCGGCGCGGGGCGGGG - Exonic
1176194588 20:63831339-63831361 GCGGCCGGGCGCGCGCCGGGGGG - Intergenic
1176223614 20:63981645-63981667 GCGGGCGGGCGGGCGGGGGGGGG - Intronic
1176234937 20:64049688-64049710 GCGGCGGGGCGGGCGGGCGGGGG + Intergenic
1178610384 21:34073998-34074020 GCGGCCCGCCGGGCGGGGGGCGG + Intronic
1178948461 21:36966807-36966829 GCGGCGGGAGGGGCGGGGGGGGG + Intronic
1178992637 21:37367706-37367728 GAGGCCGGCCGGGCGGAGGGAGG + Intronic
1179213732 21:39349115-39349137 GCGGCCGGGGACGCGGGGGGAGG - Exonic
1179796828 21:43789779-43789801 GCGGCTGGCGTCTCGGGGGCCGG + Intronic
1180182873 21:46125647-46125669 GCGGGGGGCCGGGCGGGGCGTGG + Intronic
1180309610 22:11158644-11158666 GAGGCGGGCCGCGCGGGGAGGGG + Intergenic
1180342437 22:11629089-11629111 GGGGCTGGCCGCGATGGCGGCGG + Intergenic
1180548087 22:16520454-16520476 GAGGCGGGCCGCGCGGGGAGGGG + Intergenic
1180614768 22:17120226-17120248 GGCGCCGGCGGCGCGGGGGGCGG - Exonic
1180620603 22:17159290-17159312 GCGGACGGACTCGCGGGGGGGGG - Intronic
1180649895 22:17369336-17369358 GCAGCTGTCCGGGCGGGGGTGGG + Intronic
1180949615 22:19715130-19715152 GTGGCAGGCCACGCTGGGGGAGG + Intronic
1180950655 22:19719075-19719097 GCGCCTGGGCGCGCGGGCGGGGG + Intronic
1181064480 22:20299116-20299138 GCGGCTGGGAGCGCGGGGCGGGG + Intergenic
1181064525 22:20299266-20299288 GCGGCTGGGAGCGCGGGGCGCGG + Intergenic
1181280594 22:21717132-21717154 GGGGCTGGGGGGGCGGGGGGCGG + Intronic
1181374105 22:22441952-22441974 GCGGCTGGCTGGGCGGGGGCTGG - Intergenic
1181737568 22:24893621-24893643 GCGGCTGGCCTCGGGGAGCGCGG + Intronic
1182211365 22:28679908-28679930 GAGGCGGGGCGCGCGGGGAGGGG - Intergenic
1182331165 22:29552581-29552603 GCGGCTGGCCGGGCTGGGGCTGG - Intronic
1182548795 22:31090333-31090355 GAGGCTGGCCTAGCTGGGGGCGG - Intronic
1182664108 22:31944842-31944864 GCGGCTGGCCGGGGGGGGCCTGG + Intronic
1183149935 22:36029020-36029042 GTGGCGGCCCGCGGGGGGGGCGG + Intergenic
1183367127 22:37412741-37412763 GCGGCTGCCAGCGGGGTGGGTGG + Intronic
1183546287 22:38456043-38456065 GCCGCGGGCCCCGCGGGAGGGGG - Intergenic
1183577419 22:38700835-38700857 GCGGCCGGGGGCGCGGCGGGAGG - Intronic
1183744791 22:39686145-39686167 GGGGCTGGCGGCGGGGGCGGCGG - Exonic
1183953749 22:41367338-41367360 GCAGGTGGCCGAGCCGGGGGTGG + Intronic
1184236828 22:43187276-43187298 GAGGCGGGCGGGGCGGGGGGCGG - Intergenic
1184386897 22:44181717-44181739 GCGGCAGGGCCCGAGGGGGGTGG - Intronic
1184682600 22:46080160-46080182 GAGGCTGGCCGGGCGGGAGAGGG - Intronic
951814326 3:26736743-26736765 GTGGCTGTCTGCACGGGGGGAGG - Intergenic
952744445 3:36764208-36764230 GGGGCTGGCCGGGCCGGGGGCGG + Intergenic
953013646 3:39052195-39052217 GCGGCCGGCCACGAGGGGTGGGG + Intronic
953391501 3:42536358-42536380 GGGGCTGGCCGCGCCCGGGCAGG - Exonic
953963438 3:47283682-47283704 CCTGCTGGCCGCGTGGGGAGAGG + Intronic
954140362 3:48601857-48601879 GCTGCTGGCCCTGCAGGGGGTGG + Intronic
954313298 3:49786537-49786559 GCGGCTAGCCGAGGGGGCGGGGG + Intronic
954796102 3:53161933-53161955 GCGGCTGGACTGGCAGGGGGCGG - Intronic
956179071 3:66500869-66500891 GCGGCCGGCCCCGCGCTGGGAGG + Exonic
956675077 3:71725449-71725471 GGGGCGGGGCGCGCGGGGCGGGG - Intronic
958718958 3:97821965-97821987 GGGGCGGGCCGCGCCGGGCGAGG + Intergenic
959042641 3:101439408-101439430 GCGGCTGGCCGGGGGGGGGCTGG - Intronic
961827360 3:129606128-129606150 TCGGCGGGCGGCGCGGCGGGCGG + Exonic
962245279 3:133785634-133785656 GCGGCTGGCCGGGCGGGGGGGGG - Intronic
962277908 3:134029811-134029833 GCGGCTGGCCGGGCGCGGAGTGG + Exonic
963091405 3:141486938-141486960 GCGGCGGGCGGGGCGGGGCGGGG + Intergenic
964041691 3:152268845-152268867 GGGGCTGGGCGGGCGGGGGAGGG + Exonic
965757512 3:172040546-172040568 GCGGCTGGAAGCTCGGGCGGGGG + Exonic
966182225 3:177197638-177197660 GCGGGCGGGCGCGCGGGGGAGGG + Intergenic
966886467 3:184380216-184380238 GCGGAGGGCCGGGCCGGGGGCGG - Exonic
966886592 3:184380561-184380583 GCGGCGGGCGGCCCGGAGGGTGG + Intronic
967055011 3:185823995-185824017 GCTTCTGGCCGAGCGGGAGGCGG + Intronic
967711291 3:192711246-192711268 GCGGCTGGCCGGGCAGGGGCTGG - Intronic
967859795 3:194141868-194141890 GCGGCAGGCCACGCCGGGGCAGG + Intergenic
967924137 3:194633219-194633241 GCGGCTGGGCGCGCGGCGCGGGG + Exonic
968064461 3:195750985-195751007 GCTGCTGGCCGCGGTGGTGGAGG - Exonic
968081484 3:195849545-195849567 GCGGCTGGCTGCGGCAGGGGTGG + Intergenic
968148248 3:196317896-196317918 GCGGGAGGCCGCGAGGCGGGCGG - Intronic
968434514 4:577457-577479 GCGGCTGGGTGCGTGGGGTGGGG + Intergenic
968514252 4:1009778-1009800 GGGCCTGGCCGGGCGGGGGCGGG - Intergenic
968803141 4:2756118-2756140 CCGCCTGGCCGCGCTGGAGGGGG - Exonic
968879903 4:3293328-3293350 GGGGCGGGCGGCGCGGGGCGCGG + Intronic
968907888 4:3463076-3463098 GCGCCTGGCGGGGCGGGGGTCGG - Intergenic
968918726 4:3511485-3511507 GTGGCTGGTGGGGCGGGGGGTGG - Exonic
969032754 4:4227277-4227299 GGGGCCGGGCGCGCGGGCGGAGG - Intergenic
969239321 4:5888630-5888652 GGGGCTGGGCGGGTGGGGGGCGG - Intronic
969379416 4:6783682-6783704 GCGGGGCGCGGCGCGGGGGGCGG + Intronic
969413359 4:7043493-7043515 GCGGCGGGTCCCGCGGGCGGCGG + Exonic
969413380 4:7043544-7043566 GCGGCGGGCCGGGCGGCGGGCGG + Exonic
971351913 4:25862916-25862938 GCGGCCGGCCCGGCCGGGGGCGG - Exonic
972304753 4:37820625-37820647 GCGGCTGGTCGGGGGGGGGGGGG - Intergenic
972396919 4:38664985-38665007 GCGGCGGGGGGCGCGGGCGGAGG - Intronic
972654199 4:41049514-41049536 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
975710598 4:77157304-77157326 GAGGGTGGGCGCGCGGGGAGCGG + Exonic
975986180 4:80202906-80202928 GCCGCAGGCGGCGCGGGCGGGGG + Exonic
976249587 4:83036259-83036281 ACGGGTGGCGGCGGGGGGGGGGG - Intronic
976475251 4:85475613-85475635 GCGGCTGCCTGCGCCAGGGGAGG + Intronic
977574070 4:98658689-98658711 GCTGCGGGCGGCGCGGGCGGAGG - Intergenic
977809701 4:101346063-101346085 GAGGGTGGCCGCGGGGGGCGCGG - Intronic
978749532 4:112231710-112231732 GGGCCTGGGCGCGCTGGGGGCGG + Intergenic
981429818 4:144645952-144645974 GCGGCTAGCCGCGACGGCGGCGG - Intergenic
982784432 4:159523813-159523835 GCGGCTGGCCGGGGGGGGGGCGG - Intergenic
983628786 4:169828563-169828585 GCGGCTGGCCCGGTGGGGGCTGG - Intergenic
984029656 4:174586889-174586911 GCGGCTGGCCGGCCGGGGGCTGG + Intergenic
984973496 4:185210171-185210193 GCGGCTGGGCGCGCGGGCTCCGG - Intronic
985122965 4:186662008-186662030 GGGGCTGGCCGGGGGGCGGGGGG - Intronic
985478409 5:92335-92357 GCGGGTGGGGGCGCGGGGGTAGG + Intergenic
985478438 5:92388-92410 GCGGGTGGGGGCGCGGGGGTAGG + Intergenic
985478477 5:92471-92493 GCGGGTGGGGGCGCGGGGGTAGG + Intergenic
986210627 5:5668001-5668023 GAGGCTGGCCGGGCAGGGAGAGG + Intergenic
986402765 5:7395988-7396010 GAGGCCGGCTGCGCGCGGGGCGG + Intergenic
986993266 5:13578595-13578617 GCGGCCGGCCGCTCCGAGGGCGG - Intergenic
987035159 5:14011846-14011868 GCGCCGCGCCGCGCTGGGGGCGG - Intergenic
987156737 5:15096608-15096630 GCGGGCGGGCGGGCGGGGGGTGG + Intergenic
987373945 5:17217539-17217561 GCGGGCGGACGCGCGGGGGGAGG + Exonic
988547655 5:32173779-32173801 GCGGCGGGCTGGGCGGGGGGCGG - Intronic
988577710 5:32443861-32443883 GGGGCTGGACGCGCGGAGGCGGG + Intronic
988777512 5:34490758-34490780 GCGGCTGGCCGGGGGTGGGCAGG + Intergenic
989368221 5:40679739-40679761 GGGGCTGGGCGCGCGGGGTGGGG - Exonic
989655796 5:43745895-43745917 GCGGCTGGCCGGGTGGGGGCTGG + Intergenic
989750258 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG + Intergenic
993836104 5:92822254-92822276 GCGGCAGGCAGCGGGGGGTGTGG + Intergenic
995402444 5:111757766-111757788 GAGGCTGGCCGGGGGCGGGGAGG - Intronic
997304975 5:132830304-132830326 GCGGCTGGGCGCGCCGCGTGTGG - Intronic
997470479 5:134114636-134114658 GGGGCGGGCCGGGCCGGGGGCGG - Intergenic
998060093 5:139112639-139112661 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
999129389 5:149271604-149271626 GGGGCAGGCCGCGCGGGCGCGGG + Intergenic
1001401925 5:171451053-171451075 GCGGCCGGCGGCGGGGTGGGGGG - Intronic
1001529930 5:172454559-172454581 GCGGGGGGCGGTGCGGGGGGCGG - Intergenic
1001529936 5:172454571-172454593 GCGGGGGGCGGTGCGGGGGGCGG - Intergenic
1001529942 5:172454583-172454605 GCGGGGGGCGGTGCGGGGGGCGG - Intergenic
1001529949 5:172454595-172454617 CGGGCCGGCGGCGCGGGGGGCGG - Intergenic
1001824708 5:174735594-174735616 GCGGCCGGCAGCGGGCGGGGCGG - Intergenic
1002064902 5:176647200-176647222 GCGGCGGCCTGCGCGGGGGCGGG + Intergenic
1002193224 5:177489599-177489621 GCGGCTGGTAGGGCTGGGGGCGG + Exonic
1002638946 5:180621517-180621539 GAGGCTGGCCGCGGGGAGGGCGG - Intronic
1003624298 6:7727845-7727867 GCGGCTGGCCGGCCGGGCCGCGG + Intronic
1004395670 6:15245201-15245223 GGGGCGGGGCGCGCGGGGAGGGG + Intergenic
1004864124 6:19837255-19837277 CCCGCTGGGCGCGCGGGCGGGGG - Intergenic
1005040334 6:21595141-21595163 GTGGCGGGCGGCGCGGGCGGTGG + Exonic
1005288995 6:24359998-24360020 GGCGCCGGCCGCGCGGGGGCGGG + Intergenic
1006472954 6:34238252-34238274 GGGCCAGGGCGCGCGGGGGGAGG - Intronic
1006498257 6:34439851-34439873 GCTGCTGGGCGGGGGGGGGGGGG - Intergenic
1006642722 6:35497117-35497139 GGGGCGGGGCGCGCAGGGGGCGG + Intergenic
1007074830 6:39059823-39059845 GCGGCAGGCAGAGCTGGGGGTGG - Intronic
1007927738 6:45663546-45663568 GCGGCGGGCCGGGCTCGGGGCGG - Intronic
1009899808 6:69797047-69797069 GCGGCGAGCCGAGCGGGGGCGGG + Exonic
1011426741 6:87239376-87239398 GCGGCTGGCGGGCCGGGGGCTGG + Intronic
1011685379 6:89819618-89819640 GCAGGTGGCCGCTCGGGGTGAGG - Exonic
1012551060 6:100465074-100465096 GAGCCTGGGCGCGCGGAGGGCGG - Intergenic
1013242716 6:108260957-108260979 GCGGCTGAACGCGGAGGGGGCGG - Exonic
1013272877 6:108559694-108559716 GCGGCGGGCCGGGCGCGCGGCGG - Intergenic
1013306181 6:108848718-108848740 GAGGGTGGCCGGGCGGGGTGAGG + Intronic
1015149222 6:130019846-130019868 GCGGCCGTCCGCGCGGGAGAGGG + Intronic
1016738552 6:147506825-147506847 GCGGCGGCCCGCGCGGGGCGGGG + Intergenic
1017981959 6:159407576-159407598 GCGGCTGGCTGGGCGGGGGCTGG - Intergenic
1018013597 6:159693332-159693354 GGGGCGGGGCCCGCGGGGGGGGG - Intronic
1018727668 6:166626647-166626669 GCCGCTGGCTGCACGGGGTGTGG - Intronic
1018935925 6:168274073-168274095 GCTGCTGGGTGCGGGGGGGGGGG + Intergenic
1018959982 6:168441268-168441290 GCGGCTGGGCGGGCGCGTGGAGG - Exonic
1019057248 6:169232482-169232504 GCTGCTCTCCGCGCGGGGTGCGG - Intronic
1019080246 6:169425271-169425293 GCGCCTGGCAGCGTGTGGGGAGG + Intergenic
1019080259 6:169425315-169425337 GCGCCTGGCAGCGTGTGGGGAGG + Intergenic
1019080272 6:169425359-169425381 GCGCCTGGCAGCGTGTGGGGAGG + Intergenic
1019080285 6:169425403-169425425 GCGCCTGGCAGCGTGTGGGGAGG + Intergenic
1019080305 6:169425469-169425491 GCGCCTGGCAGCGTGTGGGGAGG + Intergenic
1019080346 6:169425601-169425623 GCGCCTGGCAGCGTGTGGGGAGG + Intergenic
1019080352 6:169425623-169425645 GCGCCTGGCAGCGTGTGGGGAGG + Intergenic
1019080389 6:169425733-169425755 GCGCCTGGGAGCGTGGGGGGAGG + Intergenic
1019080402 6:169425777-169425799 GCGCCTGGCAGCGTGTGGGGAGG + Intergenic
1019080408 6:169425799-169425821 GCGCCTGGCAGCGTGTGGGGAGG + Intergenic
1019080414 6:169425821-169425843 GCGCCTGGCAGCGTGTGGGGAGG + Intergenic
1019271693 7:152878-152900 ACTGCTGGCCGCGAGGGAGGAGG - Intergenic
1019279519 7:192911-192933 GGAGCCGGGCGCGCGGGGGGCGG - Intergenic
1019473379 7:1232928-1232950 GCGGCGGGAGGCGCGGGCGGCGG - Exonic
1019532499 7:1510818-1510840 GCGGCTGGCAGGGTGGGGGCAGG + Intergenic
1019562549 7:1665832-1665854 GGGGCTGGCCGGGCAGGCGGGGG - Intergenic
1019738033 7:2660058-2660080 GCGGGTGGCCGTGCGGGATGGGG - Intronic
1020274336 7:6615608-6615630 GCCGCTGGCCGGGCCGGGGGCGG - Exonic
1020274381 7:6615709-6615731 GGGCCGGGCCGCGCGGGGGCCGG - Exonic
1021510503 7:21428003-21428025 GCGGCGCGCGGCGCGGGCGGCGG - Intergenic
1021827937 7:24573344-24573366 GCGGCTGGCTGCGCGCGCGGAGG + Exonic
1022106282 7:27199911-27199933 GCGGCTGCCGGGGCCGGGGGCGG - Exonic
1022375301 7:29806682-29806704 GCGGCTTCCCGCGCGGGTGCGGG + Intronic
1022700395 7:32754125-32754147 GCGGCTGGCCAGGCAGGGGCTGG - Intergenic
1023405820 7:39833293-39833315 GCGGGCGGCCGTGCGGGCGGCGG + Intergenic
1023846425 7:44123503-44123525 GCGGCGCGCCGCGCGGTGAGTGG - Exonic
1023881708 7:44324889-44324911 GCGGCAGGCGGCGGGGGTGGCGG - Intronic
1023937281 7:44748902-44748924 GCGGCGGGCGGCGCGGAGGGCGG + Intronic
1023955655 7:44885011-44885033 GCGGCTGGCGCCGAGGAGGGCGG - Exonic
1026010043 7:66629221-66629243 GCGGCGGGCCGCGGGGCGTGGGG + Intronic
1026360545 7:69598409-69598431 TGGGCTGGCCGCGGAGGGGGAGG + Intergenic
1026968299 7:74453935-74453957 GCCGCAGCCCGCGCCGGGGGTGG + Intronic
1027001642 7:74658189-74658211 GCGGCCCGCCGCGCGCGGTGTGG + Intronic
1027248022 7:76380206-76380228 GCGGGGAGCCGCGCGGGGCGGGG - Intergenic
1027592779 7:80135651-80135673 GGGGTTGGTGGCGCGGGGGGGGG - Intronic
1029075514 7:97930869-97930891 CTGGCTCTCCGCGCGGGGGGGGG - Intergenic
1029453447 7:100655541-100655563 GCTGCTGGCCGCGGAGGAGGGGG - Exonic
1029461092 7:100694181-100694203 GCGGCTAGCAGCGGGGGAGGGGG + Intergenic
1030033315 7:105388485-105388507 CCGGCGGGCGGCCCGGGGGGAGG - Intronic
1030725770 7:112922890-112922912 GCGGCTGGCCCGGGGGGGGGGGG - Intronic
1031531868 7:122886186-122886208 GCGCCGGGGCGCGCGGGCGGCGG - Exonic
1032306291 7:130734440-130734462 GCGGCGGGCTGCGGGGAGGGGGG - Intergenic
1033165514 7:139035797-139035819 GCGGCGGCCGGCGCGGTGGGCGG - Exonic
1033165612 7:139036143-139036165 GCGGGAGGCCGGGCGAGGGGCGG + Intergenic
1033300026 7:140177069-140177091 GCGGCTGGCGGAGGGGGAGGAGG + Intergenic
1033306722 7:140230773-140230795 GCTGCTGGTCCCGCGGGCGGGGG + Intergenic
1033406430 7:141074212-141074234 GCGGGCGGCCGAGCTGGGGGAGG - Exonic
1033446621 7:141428630-141428652 GCGGCTGTCCACACGTGGGGTGG - Intronic
1033732824 7:144195631-144195653 GGGGCGGGCCGCGGGTGGGGCGG - Exonic
1033750227 7:144355386-144355408 GGGGCGGGCCGCGGGTGGGGCGG + Exonic
1034418743 7:150978244-150978266 GCGGCTGTCGGCGCGGTGGCAGG - Exonic
1034469782 7:151248971-151248993 GCGGGAGGCGGCGCGGGGAGGGG + Exonic
1034620282 7:152451660-152451682 GCGGCGGGGGGCGGGGGGGGGGG - Intergenic
1035476066 7:159144960-159144982 GCGGCGGGGCGCGTGGGGGACGG - Intergenic
1035717180 8:1763606-1763628 GCGGGGCGCGGCGCGGGGGGCGG - Intronic
1036967742 8:13319461-13319483 CCTGCTGGCGGGGCGGGGGGGGG + Intronic
1037529192 8:19757276-19757298 GCGGCTGCCGGAGCGGGAGGTGG - Intronic
1037575299 8:20197270-20197292 GCGGCCGGCGGCGAAGGGGGCGG + Intergenic
1037769179 8:21789021-21789043 GCGGCTGGCGGCGCGGGGCGCGG + Intronic
1037802455 8:22043056-22043078 GGGGCTGGCAGGGCGGGGGCGGG + Intronic
1037826928 8:22165229-22165251 GCCGCGGACCGAGCGGGGGGCGG + Exonic
1037886711 8:22599548-22599570 GGGGCTGGGGGGGCGGGGGGCGG - Intronic
1038540175 8:28385400-28385422 GCGGGTGCCCGGGGGGGGGGCGG - Intronic
1038644454 8:29350801-29350823 GCGGGGGACAGCGCGGGGGGCGG - Intergenic
1038963500 8:32548087-32548109 CGCGCTGGCCGGGCGGGGGGTGG - Intronic
1039798135 8:40932832-40932854 GCGGCGGGCGGCGAGGGTGGGGG - Intergenic
1039843400 8:41309207-41309229 GCGGCAGGACGCGCGCGGGGAGG - Exonic
1039945415 8:42124724-42124746 GCGGCGGGAGGGGCGGGGGGTGG - Intergenic
1039996884 8:42541762-42541784 GGGGCGGGCGGCGCGGGGCGGGG - Intronic
1040032962 8:42842921-42842943 GCGCGTGTCCGCGCGAGGGGCGG - Intronic
1040032970 8:42842950-42842972 GCGGCCGGCGGGGCCGGGGGCGG - Intronic
1040474472 8:47764376-47764398 GCGGCTGGATCCGCGGTGGGAGG + Intergenic
1041068066 8:54101588-54101610 GCGGCCGGGTCCGCGGGGGGCGG - Intronic
1042281977 8:67064730-67064752 GCGGCTGGGTGCGGTGGGGGAGG + Intronic
1042912888 8:73845056-73845078 GCAGCTGGCCGGGCGGGGGCTGG - Intronic
1043527473 8:81112155-81112177 GGGGCGGGCCGCGGGGCGGGAGG + Intergenic
1044591622 8:93917859-93917881 GCTGCTGCCCGCGCGGGTTGTGG + Intronic
1044637400 8:94340908-94340930 GCGGTTGGCCGGGCAGGGGCTGG - Intergenic
1047998473 8:130358249-130358271 GCGCCAGGCCGGGCGGCGGGTGG - Intronic
1049203130 8:141351448-141351470 GGGGCTGGCCACGTGGGGGTAGG + Intergenic
1049235027 8:141508108-141508130 TCTGCCGGCCGCGCGGGGGCCGG - Intergenic
1049396350 8:142402953-142402975 GCGGGAGGCCGGGCGGGGGGCGG - Intronic
1049405459 8:142450124-142450146 GGGGCTGGGGGCGCGGCGGGTGG + Intronic
1049532247 8:143160355-143160377 GGCGGGGGCCGCGCGGGGGGCGG + Intronic
1049565283 8:143334918-143334940 GGGGCTGGCCGCTGGGGGCGGGG - Intronic
1049639343 8:143707603-143707625 GCTGGTGGCCGGGCCGGGGGCGG - Intronic
1049773267 8:144393416-144393438 GGGGCGGGGCGCGCGGGGGGCGG + Intronic
1049798361 8:144506623-144506645 GCAGCTGCCCCCGCGGGCGGTGG + Exonic
1049807592 8:144547975-144547997 GCTGCTGGCAGGGCGAGGGGGGG + Exonic
1049826414 8:144671692-144671714 GTGGCTGGCCGGGAGGGGCGTGG - Intergenic
1051079546 9:13279186-13279208 GCGCCGGGCCGCGCGGGGTGGGG + Intronic
1052494933 9:29213474-29213496 GGGGCTGGGCGGGCGGCGGGCGG + Intergenic
1054820453 9:69516216-69516238 GCGGTGGGCCCCGCGGGCGGCGG - Exonic
1055501546 9:76906577-76906599 TCGGCTGGCCTGGCCGGGGGAGG + Intergenic
1056078349 9:83063259-83063281 GCTGCTTGCCGCGCAGGTGGGGG + Intergenic
1056579534 9:87880776-87880798 GTGGTTGGCGGGGCGGGGGGGGG + Intergenic
1056732573 9:89178504-89178526 GCGGCAGCCCGCGCCGGGGCCGG - Exonic
1057054178 9:91949080-91949102 GAGGCTGGCGGCGGGAGGGGCGG - Intronic
1057276105 9:93676742-93676764 GCTGCTGGCCGTGCTGGTGGAGG - Exonic
1057390724 9:94639679-94639701 GCGGCAGGGCGCGTGGGGGCGGG - Intronic
1057490449 9:95516212-95516234 GGGGCTGGCCTCGGGGGCGGGGG + Intronic
1057716674 9:97501570-97501592 GCGGCGGGCGGGGCGGGGCGCGG + Intronic
1057995636 9:99820047-99820069 GGGGCAGGGCGCGCGGGGCGGGG - Intergenic
1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG + Exonic
1058425841 9:104874829-104874851 GTGGCTGGCCGGGCGGGGGCTGG - Intronic
1058866617 9:109167049-109167071 GGGGCTGGCTGCGCAGGCGGCGG + Exonic
1059483671 9:114611399-114611421 GGGGCCGGCCGGGCGGGGGGCGG + Exonic
1060389933 9:123268707-123268729 GCGGCAGGACGCGCGTGGAGGGG - Intergenic
1060479830 9:124011659-124011681 GCGGCTGGGCCCGCGGCCGGCGG + Exonic
1060629451 9:125143133-125143155 GAGGCTGGCGGCGCGGGGCCGGG - Intronic
1060700555 9:125746815-125746837 CCGGCGGGCCGCGCGCCGGGCGG - Intergenic
1060825110 9:126683297-126683319 GCCGCGGGCCGGGCGGGCGGCGG - Intronic
1060856051 9:126915309-126915331 GCGGCTGCAGGTGCGGGGGGCGG + Intronic
1061368656 9:130185803-130185825 GCTGCTGGGCGCGCAGGGGGTGG - Intronic
1061913727 9:133738366-133738388 GGGGCTGGCAGCGAGGGTGGGGG - Intronic
1061975883 9:134067888-134067910 GCGGCGGGCGGCGCGGGCGGCGG - Intronic
1062022538 9:134326273-134326295 GGGGCTGGGCGGGCGGGGCGCGG + Intronic
1062272120 9:135714432-135714454 GCGGGCGGCCGGGCGGGGGCGGG - Intronic
1062364710 9:136203184-136203206 GCCTCTGGCCGAGCGGAGGGCGG + Intronic
1062390597 9:136332173-136332195 GCGGCGGGCAGCGAGTGGGGTGG + Intronic
1062500418 9:136849683-136849705 GGGGCTGGCGGGGCGGGGGCGGG + Intronic
1062596713 9:137302844-137302866 GAGGCTGCCCGCGCGCGGGAAGG - Intergenic
1062637784 9:137500613-137500635 GAGGCCGGCCACGCGGGGAGGGG + Intronic
1062659179 9:137619286-137619308 GCGGCTGGGGGAGCGGGCGGGGG + Intronic
1203774085 EBV:63132-63154 GCTGCTGGCCCCGGGGGAGGTGG + Intergenic
1203562683 Un_KI270744v1:71730-71752 GCGGCTGGCCGGGCGGGGGGCGG - Intergenic
1186244907 X:7608914-7608936 GCGGCTGGCCGGGCAGGGGGCGG + Intergenic
1186410756 X:9342760-9342782 GCGGCCGGCGGCGTGGGGGCGGG - Intergenic
1186626442 X:11298757-11298779 GCTGCTGGGCGGGCGGAGGGAGG - Exonic
1186888626 X:13938713-13938735 GGGGCCGGCCGCGCGGAGAGGGG + Intergenic
1187332653 X:18354728-18354750 CGGGCCGGCCGCGCGGGGGGCGG - Intergenic
1187871277 X:23767073-23767095 GAGGCTGGCGGCGTGGGGTGGGG - Intergenic
1188242644 X:27809485-27809507 GGGGCGGGCGGGGCGGGGGGGGG - Intronic
1189137107 X:38561485-38561507 GCGGGCGGGCGCGCGGGAGGGGG - Exonic
1189262479 X:39688675-39688697 GCGGCTGGCCCCCAGGGGTGGGG + Intergenic
1189323443 X:40099197-40099219 GCGGCTCTGGGCGCGGGGGGAGG + Intronic
1189825219 X:44911106-44911128 GCGGCTGGCCGGGCGGGGGCTGG + Intronic
1189837537 X:45040247-45040269 GCGGCTGGCCCGGGGGGTGGGGG + Intronic
1190108442 X:47574510-47574532 GCTGCTGGCCCTGCGGGGGCGGG + Exonic
1190680908 X:52826944-52826966 GCGGCTGGCCGGGCGGGGGGTGG + Intergenic
1191068931 X:56380177-56380199 GTGGCTGGCCGGGTGGGGGCTGG + Intergenic
1193130095 X:77910648-77910670 GCGGCTGGCCGCCGCGGCGGGGG + Intronic
1195060754 X:101191635-101191657 GCCGCTGCCCGGGCGGGAGGAGG + Intergenic
1196842539 X:119871806-119871828 GCGGCCGCCCGCGAGCGGGGCGG - Exonic
1197800199 X:130340024-130340046 GCGCCAGGCCGCGCGGGGCCGGG + Intronic
1198767159 X:140091569-140091591 GCGGGCGGGCGCGCGGGCGGCGG - Intergenic
1199445053 X:147911833-147911855 GGGGCTGAGCCCGCGGGGGGAGG + Intergenic
1199491336 X:148403662-148403684 TCGGGTGGCGGGGCGGGGGGGGG - Intergenic
1199736871 X:150693555-150693577 GCGGCGGGCTGCGAGGGCGGCGG + Exonic
1200142888 X:153910540-153910562 GCGGCTGCCCGCGCCGGTGCTGG - Exonic
1200239475 X:154486330-154486352 GCACCTGGCCGCGCGGAGGGTGG + Exonic