ID: 1058180617 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:101793630-101793652 |
Sequence | GGTCGAATCCGCATTCATAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 51 | |||
Summary | {0: 1, 1: 2, 2: 4, 3: 21, 4: 23} |
Found 0 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
---|
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1058180617 | Original CRISPR | GGTCGAATCCGCATTCATAG GGG | Intergenic | ||