ID: 1058180617

View in Genome Browser
Species Human (GRCh38)
Location 9:101793630-101793652
Sequence GGTCGAATCCGCATTCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 2, 2: 4, 3: 21, 4: 23}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058180617 Original CRISPR GGTCGAATCCGCATTCATAG GGG Intergenic
908867433 1:68566114-68566136 GGTAGATTCCGCATCCACAGTGG + Intergenic
923616413 1:235541972-235541994 GGTCAAATCTGCATTCACAGGGG + Intergenic
1068211314 10:53924256-53924278 GGTGGACTCCGCACTCAGAGCGG + Intronic
1076280270 10:129240929-129240951 TGTCGAATCCACATTCAATGTGG + Intergenic
1096239774 12:49953612-49953634 GGTAGATTCCGGACTCATAGCGG + Intronic
1105626004 13:22113214-22113236 GGTCAAACCCGCATTCGTAAGGG + Intergenic
1127350873 15:58150724-58150746 AGTCAAATCCGCATTCATAAGGG - Intronic
1133992871 16:10723643-10723665 GATCAAATCCACATTCATAAGGG + Intergenic
1147933520 17:43997736-43997758 GGTCGAAGCCGCATTCGTAAGGG - Intronic
1166786139 19:45368471-45368493 GGTCAAATTCTCATTCATCGTGG - Intronic
1202644483 1_KI270706v1_random:128218-128240 GGTCAAATCTGCATTCATAAGGG - Intergenic
932743891 2:74315093-74315115 GGTCAAATCCACAGTCATAATGG + Intronic
937202449 2:120213039-120213061 GGTCAAATCCGCATTCATAGAGG - Intergenic
938309427 2:130278140-130278162 AGTCAAATCCGCATTTGTAGGGG - Intergenic
938446068 2:131379957-131379979 AGTCAAATCCTCATTCGTAGGGG + Intergenic
944741518 2:202617388-202617410 GGTCAAATCCGCATTCATAGGGG - Intergenic
945119132 2:206440771-206440793 AATCAAATCAGCATTCATAGAGG - Intergenic
945290667 2:208124297-208124319 GGTCGCTGCTGCATTCATAGTGG + Exonic
948376447 2:237524106-237524128 GGTCAAATCCTCATTGACAGGGG + Intronic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1171894444 20:30747145-30747167 GGTCAAATCTGCATTCATAAGGG - Intergenic
1176607398 21:8844436-8844458 GGTCAAATCTGCATTCATAAGGG + Intergenic
1180357481 22:11854223-11854245 GGTCAAATCTGCATTCATAAGGG + Intergenic
1180380786 22:12138108-12138130 GGTCAAATCTGCATTCATAAGGG - Intergenic
1185228331 22:49666422-49666444 GGTCGCAGCATCATTCATAGAGG - Intergenic
959483052 3:106896695-106896717 GGTCAAAGCCGCATTCATAGGGG + Intergenic
965238555 3:166160991-166161013 GGTCAAATCCGCATTCGTAGGGG + Intergenic
971335536 4:25720317-25720339 GGTCAAATCCACATTCATAGGGG + Intergenic
973370720 4:49246777-49246799 GGTCAAATCTGCATTCATAAGGG - Intergenic
973390307 4:49548680-49548702 GGTCAAATCTGCATTCATAAGGG + Intergenic
974639607 4:64611179-64611201 GATCAAACCCGCATTCATAAGGG + Intergenic
987027692 5:13944087-13944109 GGTCAAAAACACATTCATAGTGG - Intronic
994459088 5:100050937-100050959 GGTCGAAGCCACATTCGTAAGGG + Intergenic
995285021 5:110378237-110378259 GATGGAATCCACATTCTTAGAGG + Intronic
1025226442 7:57168830-57168852 GGTCAAATCCGCATTCGTAGGGG - Intergenic
1025229495 7:57192095-57192117 GGTCAAATCTGCATTCGTAGGGG - Intergenic
1025730851 7:64105869-64105891 GGTCAAATCTGCATTTGTAGGGG + Intronic
1030057457 7:105596013-105596035 GGTTGAATCAGCATTTATAGAGG - Intronic
1048337763 8:133515505-133515527 GGTCAAAACCTCATTCGTAGGGG - Intronic
1050387589 9:5107328-5107350 GGTCAAATCTGCCTTCATAGGGG - Intronic
1054354208 9:64045626-64045648 GGTCAAATCTGCATTCATAAGGG + Intergenic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1058878520 9:109265916-109265938 GCTAGAAGCAGCATTCATAGAGG + Intronic
1202630198 M:10163-10185 GGTCGAAGCCGCACTCGTAAGGG - Intergenic
1203695132 Un_GL000214v1:91578-91600 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203742540 Un_GL000218v1:14738-14760 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203702731 Un_KI270742v1:9325-9347 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203567558 Un_KI270744v1:104681-104703 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203641141 Un_KI270751v1:12485-12507 GGTCAAATCTGCATTCATAAGGG + Intergenic
1196963054 X:121025006-121025028 GGTAGATTCTGCATTCATAGAGG + Intergenic
1201156068 Y:11132215-11132237 GGTCAAATCTGCATTCATAAGGG + Intergenic