ID: 1058180617

View in Genome Browser
Species Human (GRCh38)
Location 9:101793630-101793652
Sequence GGTCGAATCCGCATTCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 2, 2: 4, 3: 21, 4: 23}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058180617 Original CRISPR GGTCGAATCCGCATTCATAG GGG Intergenic