ID: 1058181259

View in Genome Browser
Species Human (GRCh38)
Location 9:101802992-101803014
Sequence AGGCAGAAGACTGCATCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058181259_1058181262 8 Left 1058181259 9:101802992-101803014 CCTCAAGATGCAGTCTTCTGCCT No data
Right 1058181262 9:101803023-101803045 TATTGCCCTTCACTGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058181259 Original CRISPR AGGCAGAAGACTGCATCTTG AGG (reversed) Intergenic
No off target data available for this crispr