ID: 1058185038

View in Genome Browser
Species Human (GRCh38)
Location 9:101845088-101845110
Sequence GGACTCCAGGTAAGAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058185038_1058185040 -7 Left 1058185038 9:101845088-101845110 CCAACTTCTCTTACCTGGAGTCC No data
Right 1058185040 9:101845104-101845126 GGAGTCCTGATCTCATAACAAGG No data
1058185038_1058185041 -6 Left 1058185038 9:101845088-101845110 CCAACTTCTCTTACCTGGAGTCC No data
Right 1058185041 9:101845105-101845127 GAGTCCTGATCTCATAACAAGGG No data
1058185038_1058185044 1 Left 1058185038 9:101845088-101845110 CCAACTTCTCTTACCTGGAGTCC No data
Right 1058185044 9:101845112-101845134 GATCTCATAACAAGGGTTTTGGG No data
1058185038_1058185043 0 Left 1058185038 9:101845088-101845110 CCAACTTCTCTTACCTGGAGTCC No data
Right 1058185043 9:101845111-101845133 TGATCTCATAACAAGGGTTTTGG No data
1058185038_1058185045 28 Left 1058185038 9:101845088-101845110 CCAACTTCTCTTACCTGGAGTCC No data
Right 1058185045 9:101845139-101845161 GATAATCTGCCATGTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058185038 Original CRISPR GGACTCCAGGTAAGAGAAGT TGG (reversed) Intergenic