ID: 1058185244

View in Genome Browser
Species Human (GRCh38)
Location 9:101847054-101847076
Sequence GCTTATGTATGTGTAGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058185244_1058185245 7 Left 1058185244 9:101847054-101847076 CCATTATCTACACATACATAAGC No data
Right 1058185245 9:101847084-101847106 TCTATAATGTAAGCTTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058185244 Original CRISPR GCTTATGTATGTGTAGATAA TGG (reversed) Intergenic
No off target data available for this crispr