ID: 1058188388

View in Genome Browser
Species Human (GRCh38)
Location 9:101883480-101883502
Sequence TTATAGGTAAACAATTAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058188388_1058188392 20 Left 1058188388 9:101883480-101883502 CCTGTCTAATTGTTTACCTATAA No data
Right 1058188392 9:101883523-101883545 AAGTCCTTAGTAATTAAAAATGG No data
1058188388_1058188390 -3 Left 1058188388 9:101883480-101883502 CCTGTCTAATTGTTTACCTATAA No data
Right 1058188390 9:101883500-101883522 TAAGCAAAGTTTGTGTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058188388 Original CRISPR TTATAGGTAAACAATTAGAC AGG (reversed) Intergenic
No off target data available for this crispr