ID: 1058194536

View in Genome Browser
Species Human (GRCh38)
Location 9:101956540-101956562
Sequence GATCTAAGGTGACCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058194536_1058194543 17 Left 1058194536 9:101956540-101956562 CCTGCCTTTGGTCACCTTAGATC No data
Right 1058194543 9:101956580-101956602 TACTCATCCAGTGTTGGGCAGGG No data
1058194536_1058194541 12 Left 1058194536 9:101956540-101956562 CCTGCCTTTGGTCACCTTAGATC No data
Right 1058194541 9:101956575-101956597 ATTTTTACTCATCCAGTGTTGGG No data
1058194536_1058194540 11 Left 1058194536 9:101956540-101956562 CCTGCCTTTGGTCACCTTAGATC No data
Right 1058194540 9:101956574-101956596 GATTTTTACTCATCCAGTGTTGG No data
1058194536_1058194542 16 Left 1058194536 9:101956540-101956562 CCTGCCTTTGGTCACCTTAGATC No data
Right 1058194542 9:101956579-101956601 TTACTCATCCAGTGTTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058194536 Original CRISPR GATCTAAGGTGACCAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr