ID: 1058196125

View in Genome Browser
Species Human (GRCh38)
Location 9:101978658-101978680
Sequence TTATATTGAGATATCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058196125_1058196128 -8 Left 1058196125 9:101978658-101978680 CCCACCTGGATATCTCAATATAA No data
Right 1058196128 9:101978673-101978695 CAATATAATCTCCCTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058196125 Original CRISPR TTATATTGAGATATCCAGGT GGG (reversed) Intergenic
No off target data available for this crispr