ID: 1058196128

View in Genome Browser
Species Human (GRCh38)
Location 9:101978673-101978695
Sequence CAATATAATCTCCCTGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058196120_1058196128 11 Left 1058196120 9:101978639-101978661 CCCTTGTGTTGCCCTTGCACCCA No data
Right 1058196128 9:101978673-101978695 CAATATAATCTCCCTGTCTCAGG No data
1058196124_1058196128 -1 Left 1058196124 9:101978651-101978673 CCTTGCACCCACCTGGATATCTC No data
Right 1058196128 9:101978673-101978695 CAATATAATCTCCCTGTCTCAGG No data
1058196125_1058196128 -8 Left 1058196125 9:101978658-101978680 CCCACCTGGATATCTCAATATAA No data
Right 1058196128 9:101978673-101978695 CAATATAATCTCCCTGTCTCAGG No data
1058196119_1058196128 30 Left 1058196119 9:101978620-101978642 CCTTTTCGACTTAAAAGGTCCCT No data
Right 1058196128 9:101978673-101978695 CAATATAATCTCCCTGTCTCAGG No data
1058196123_1058196128 0 Left 1058196123 9:101978650-101978672 CCCTTGCACCCACCTGGATATCT No data
Right 1058196128 9:101978673-101978695 CAATATAATCTCCCTGTCTCAGG No data
1058196121_1058196128 10 Left 1058196121 9:101978640-101978662 CCTTGTGTTGCCCTTGCACCCAC No data
Right 1058196128 9:101978673-101978695 CAATATAATCTCCCTGTCTCAGG No data
1058196126_1058196128 -9 Left 1058196126 9:101978659-101978681 CCACCTGGATATCTCAATATAAT No data
Right 1058196128 9:101978673-101978695 CAATATAATCTCCCTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058196128 Original CRISPR CAATATAATCTCCCTGTCTC AGG Intergenic
No off target data available for this crispr