ID: 1058200037

View in Genome Browser
Species Human (GRCh38)
Location 9:102027921-102027943
Sequence TGTCAGCTATAGAACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058200034_1058200037 -2 Left 1058200034 9:102027900-102027922 CCCAGGGAGTAATTAGAACTCTG No data
Right 1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG No data
1058200026_1058200037 20 Left 1058200026 9:102027878-102027900 CCCCACCCCACTGGCACTGCAGC No data
Right 1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG No data
1058200028_1058200037 18 Left 1058200028 9:102027880-102027902 CCACCCCACTGGCACTGCAGCCC No data
Right 1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG No data
1058200025_1058200037 24 Left 1058200025 9:102027874-102027896 CCTGCCCCACCCCACTGGCACTG No data
Right 1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG No data
1058200029_1058200037 15 Left 1058200029 9:102027883-102027905 CCCCACTGGCACTGCAGCCCAGG No data
Right 1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG No data
1058200027_1058200037 19 Left 1058200027 9:102027879-102027901 CCCACCCCACTGGCACTGCAGCC No data
Right 1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG No data
1058200033_1058200037 13 Left 1058200033 9:102027885-102027907 CCACTGGCACTGCAGCCCAGGGA No data
Right 1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG No data
1058200031_1058200037 14 Left 1058200031 9:102027884-102027906 CCCACTGGCACTGCAGCCCAGGG No data
Right 1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG No data
1058200035_1058200037 -3 Left 1058200035 9:102027901-102027923 CCAGGGAGTAATTAGAACTCTGT No data
Right 1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058200037 Original CRISPR TGTCAGCTATAGAACATGGA TGG Intergenic
No off target data available for this crispr