ID: 1058201788

View in Genome Browser
Species Human (GRCh38)
Location 9:102052091-102052113
Sequence TCATCTTCATGGAGCTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058201788_1058201792 23 Left 1058201788 9:102052091-102052113 CCATCAGAGCTCCATGAAGATGA No data
Right 1058201792 9:102052137-102052159 AGTATTCTTCCTTTCCAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058201788 Original CRISPR TCATCTTCATGGAGCTCTGA TGG (reversed) Intergenic