ID: 1058204656

View in Genome Browser
Species Human (GRCh38)
Location 9:102088241-102088263
Sequence CTGTTTCTGTAGAAGTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058204655_1058204656 10 Left 1058204655 9:102088208-102088230 CCAATCAAAGCACAGGAAAGCTC No data
Right 1058204656 9:102088241-102088263 CTGTTTCTGTAGAAGTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058204656 Original CRISPR CTGTTTCTGTAGAAGTATGC AGG Intergenic
No off target data available for this crispr