ID: 1058205380

View in Genome Browser
Species Human (GRCh38)
Location 9:102099761-102099783
Sequence CTGAATACAAAGATTAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058205375_1058205380 7 Left 1058205375 9:102099731-102099753 CCAAGGCTTTTTCTCTTCTCTTG No data
Right 1058205380 9:102099761-102099783 CTGAATACAAAGATTAATCAGGG No data
1058205374_1058205380 13 Left 1058205374 9:102099725-102099747 CCTTTTCCAAGGCTTTTTCTCTT No data
Right 1058205380 9:102099761-102099783 CTGAATACAAAGATTAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058205380 Original CRISPR CTGAATACAAAGATTAATCA GGG Intergenic
No off target data available for this crispr