ID: 1058205401

View in Genome Browser
Species Human (GRCh38)
Location 9:102099983-102100005
Sequence CCACGTTGGCACCTATTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058205397_1058205401 16 Left 1058205397 9:102099944-102099966 CCATAAGTATGCTCCACTTAACT No data
Right 1058205401 9:102099983-102100005 CCACGTTGGCACCTATTTCCTGG No data
1058205398_1058205401 3 Left 1058205398 9:102099957-102099979 CCACTTAACTTTCTGCGCATGAA No data
Right 1058205401 9:102099983-102100005 CCACGTTGGCACCTATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058205401 Original CRISPR CCACGTTGGCACCTATTTCC TGG Intergenic
No off target data available for this crispr