ID: 1058211834

View in Genome Browser
Species Human (GRCh38)
Location 9:102178217-102178239
Sequence GCACAGCTGAGAGAGCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058211834_1058211836 9 Left 1058211834 9:102178217-102178239 CCAAACAGCTCTCTCAGCTGTGC No data
Right 1058211836 9:102178249-102178271 TTGAGAACTGTAGGCATGCAAGG No data
1058211834_1058211840 29 Left 1058211834 9:102178217-102178239 CCAAACAGCTCTCTCAGCTGTGC No data
Right 1058211840 9:102178269-102178291 AGGTGTTGATGAGGGCTGCTGGG No data
1058211834_1058211837 20 Left 1058211834 9:102178217-102178239 CCAAACAGCTCTCTCAGCTGTGC No data
Right 1058211837 9:102178260-102178282 AGGCATGCAAGGTGTTGATGAGG No data
1058211834_1058211839 28 Left 1058211834 9:102178217-102178239 CCAAACAGCTCTCTCAGCTGTGC No data
Right 1058211839 9:102178268-102178290 AAGGTGTTGATGAGGGCTGCTGG No data
1058211834_1058211838 21 Left 1058211834 9:102178217-102178239 CCAAACAGCTCTCTCAGCTGTGC No data
Right 1058211838 9:102178261-102178283 GGCATGCAAGGTGTTGATGAGGG No data
1058211834_1058211835 0 Left 1058211834 9:102178217-102178239 CCAAACAGCTCTCTCAGCTGTGC No data
Right 1058211835 9:102178240-102178262 TTAGTGCTTTTGAGAACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058211834 Original CRISPR GCACAGCTGAGAGAGCTGTT TGG (reversed) Intergenic
No off target data available for this crispr