ID: 1058211840

View in Genome Browser
Species Human (GRCh38)
Location 9:102178269-102178291
Sequence AGGTGTTGATGAGGGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058211834_1058211840 29 Left 1058211834 9:102178217-102178239 CCAAACAGCTCTCTCAGCTGTGC No data
Right 1058211840 9:102178269-102178291 AGGTGTTGATGAGGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058211840 Original CRISPR AGGTGTTGATGAGGGCTGCT GGG Intergenic
No off target data available for this crispr