ID: 1058218064

View in Genome Browser
Species Human (GRCh38)
Location 9:102259719-102259741
Sequence ATGCCTTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058218064_1058218066 4 Left 1058218064 9:102259719-102259741 CCTTCACTCTTCTAGAAAGGCAT No data
Right 1058218066 9:102259746-102259768 TGTTAGGTCCTTTTCTTTCAAGG No data
1058218064_1058218067 9 Left 1058218064 9:102259719-102259741 CCTTCACTCTTCTAGAAAGGCAT No data
Right 1058218067 9:102259751-102259773 GGTCCTTTTCTTTCAAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058218064 Original CRISPR ATGCCTTTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr