ID: 1058218067 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:102259751-102259773 |
| Sequence | GGTCCTTTTCTTTCAAGGTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1058218064_1058218067 | 9 | Left | 1058218064 | 9:102259719-102259741 | CCTTCACTCTTCTAGAAAGGCAT | No data | ||
| Right | 1058218067 | 9:102259751-102259773 | GGTCCTTTTCTTTCAAGGTTTGG | No data | ||||
| 1058218062_1058218067 | 17 | Left | 1058218062 | 9:102259711-102259733 | CCAGGAGGCCTTCACTCTTCTAG | 0: 27 1: 53 2: 45 3: 55 4: 162 |
||
| Right | 1058218067 | 9:102259751-102259773 | GGTCCTTTTCTTTCAAGGTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1058218067 | Original CRISPR | GGTCCTTTTCTTTCAAGGTT TGG | Intergenic | ||
| No off target data available for this crispr | |||||