ID: 1058218067

View in Genome Browser
Species Human (GRCh38)
Location 9:102259751-102259773
Sequence GGTCCTTTTCTTTCAAGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058218064_1058218067 9 Left 1058218064 9:102259719-102259741 CCTTCACTCTTCTAGAAAGGCAT No data
Right 1058218067 9:102259751-102259773 GGTCCTTTTCTTTCAAGGTTTGG No data
1058218062_1058218067 17 Left 1058218062 9:102259711-102259733 CCAGGAGGCCTTCACTCTTCTAG 0: 27
1: 53
2: 45
3: 55
4: 162
Right 1058218067 9:102259751-102259773 GGTCCTTTTCTTTCAAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058218067 Original CRISPR GGTCCTTTTCTTTCAAGGTT TGG Intergenic
No off target data available for this crispr