ID: 1058219322

View in Genome Browser
Species Human (GRCh38)
Location 9:102277419-102277441
Sequence GAAAACATGGTGCCACACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058219322_1058219328 23 Left 1058219322 9:102277419-102277441 CCATCGTGTGGCACCATGTTTTC No data
Right 1058219328 9:102277465-102277487 TCTCTTTCCTTGTGTGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058219322 Original CRISPR GAAAACATGGTGCCACACGA TGG (reversed) Intergenic
No off target data available for this crispr