ID: 1058229481

View in Genome Browser
Species Human (GRCh38)
Location 9:102408214-102408236
Sequence AAACTCTGCTTCACAAAGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058229481_1058229484 20 Left 1058229481 9:102408214-102408236 CCGATCTTTGTGAAGCAGAGTTT No data
Right 1058229484 9:102408257-102408279 ATTGAGATTATGAAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058229481 Original CRISPR AAACTCTGCTTCACAAAGAT CGG (reversed) Intergenic
No off target data available for this crispr