ID: 1058231773

View in Genome Browser
Species Human (GRCh38)
Location 9:102435280-102435302
Sequence ATATGAAAAGGTACGTGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058231773_1058231776 14 Left 1058231773 9:102435280-102435302 CCATACCACGTACCTTTTCATAT No data
Right 1058231776 9:102435317-102435339 TTTTGTATAACTCTTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058231773 Original CRISPR ATATGAAAAGGTACGTGGTA TGG (reversed) Intergenic
No off target data available for this crispr