ID: 1058239796

View in Genome Browser
Species Human (GRCh38)
Location 9:102542463-102542485
Sequence AGTTATTTACAGATGATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058239796_1058239798 15 Left 1058239796 9:102542463-102542485 CCTGACATCATCTGTAAATAACT No data
Right 1058239798 9:102542501-102542523 GACAGCTCTTAGCTTGCTACCGG No data
1058239796_1058239799 16 Left 1058239796 9:102542463-102542485 CCTGACATCATCTGTAAATAACT No data
Right 1058239799 9:102542502-102542524 ACAGCTCTTAGCTTGCTACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058239796 Original CRISPR AGTTATTTACAGATGATGTC AGG (reversed) Intergenic
No off target data available for this crispr