ID: 1058239799

View in Genome Browser
Species Human (GRCh38)
Location 9:102542502-102542524
Sequence ACAGCTCTTAGCTTGCTACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058239796_1058239799 16 Left 1058239796 9:102542463-102542485 CCTGACATCATCTGTAAATAACT No data
Right 1058239799 9:102542502-102542524 ACAGCTCTTAGCTTGCTACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058239799 Original CRISPR ACAGCTCTTAGCTTGCTACC GGG Intergenic
No off target data available for this crispr