ID: 1058240286

View in Genome Browser
Species Human (GRCh38)
Location 9:102548864-102548886
Sequence TTGTAGGCTTATAGGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058240280_1058240286 15 Left 1058240280 9:102548826-102548848 CCCACTGTATCTAGAAAGTAACT 0: 7
1: 179
2: 1415
3: 1681
4: 1374
Right 1058240286 9:102548864-102548886 TTGTAGGCTTATAGGTGGAAGGG No data
1058240281_1058240286 14 Left 1058240281 9:102548827-102548849 CCACTGTATCTAGAAAGTAACTA 0: 7
1: 196
2: 1616
3: 1823
4: 1510
Right 1058240286 9:102548864-102548886 TTGTAGGCTTATAGGTGGAAGGG No data
1058240277_1058240286 29 Left 1058240277 9:102548812-102548834 CCAAAGTCTGTACCCCCACTGTA No data
Right 1058240286 9:102548864-102548886 TTGTAGGCTTATAGGTGGAAGGG No data
1058240278_1058240286 17 Left 1058240278 9:102548824-102548846 CCCCCACTGTATCTAGAAAGTAA 0: 8
1: 167
2: 1256
3: 1664
4: 1504
Right 1058240286 9:102548864-102548886 TTGTAGGCTTATAGGTGGAAGGG No data
1058240279_1058240286 16 Left 1058240279 9:102548825-102548847 CCCCACTGTATCTAGAAAGTAAC 0: 6
1: 183
2: 1452
3: 1690
4: 1387
Right 1058240286 9:102548864-102548886 TTGTAGGCTTATAGGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058240286 Original CRISPR TTGTAGGCTTATAGGTGGAA GGG Intergenic
No off target data available for this crispr