ID: 1058240752

View in Genome Browser
Species Human (GRCh38)
Location 9:102555166-102555188
Sequence GTTCTCAGCTTGGACATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058240752_1058240755 16 Left 1058240752 9:102555166-102555188 CCAATAATGTCCAAGCTGAGAAC No data
Right 1058240755 9:102555205-102555227 CTCCATTTACAGTAGGCACAAGG No data
1058240752_1058240754 9 Left 1058240752 9:102555166-102555188 CCAATAATGTCCAAGCTGAGAAC No data
Right 1058240754 9:102555198-102555220 AACGCTACTCCATTTACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058240752 Original CRISPR GTTCTCAGCTTGGACATTAT TGG (reversed) Intergenic
No off target data available for this crispr