ID: 1058240753

View in Genome Browser
Species Human (GRCh38)
Location 9:102555176-102555198
Sequence TCTTGATTTTGTTCTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4004
Summary {0: 5, 1: 64, 2: 911, 3: 1390, 4: 1634}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058240753_1058240755 6 Left 1058240753 9:102555176-102555198 CCAAGCTGAGAACAAAATCAAGA 0: 5
1: 64
2: 911
3: 1390
4: 1634
Right 1058240755 9:102555205-102555227 CTCCATTTACAGTAGGCACAAGG No data
1058240753_1058240754 -1 Left 1058240753 9:102555176-102555198 CCAAGCTGAGAACAAAATCAAGA 0: 5
1: 64
2: 911
3: 1390
4: 1634
Right 1058240754 9:102555198-102555220 AACGCTACTCCATTTACAGTAGG No data
1058240753_1058240757 23 Left 1058240753 9:102555176-102555198 CCAAGCTGAGAACAAAATCAAGA 0: 5
1: 64
2: 911
3: 1390
4: 1634
Right 1058240757 9:102555222-102555244 ACAAGGAAAACAAAATACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058240753 Original CRISPR TCTTGATTTTGTTCTCAGCT TGG (reversed) Intergenic
Too many off-targets to display for this crispr