ID: 1058240754

View in Genome Browser
Species Human (GRCh38)
Location 9:102555198-102555220
Sequence AACGCTACTCCATTTACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058240752_1058240754 9 Left 1058240752 9:102555166-102555188 CCAATAATGTCCAAGCTGAGAAC No data
Right 1058240754 9:102555198-102555220 AACGCTACTCCATTTACAGTAGG No data
1058240753_1058240754 -1 Left 1058240753 9:102555176-102555198 CCAAGCTGAGAACAAAATCAAGA 0: 5
1: 64
2: 911
3: 1390
4: 1634
Right 1058240754 9:102555198-102555220 AACGCTACTCCATTTACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058240754 Original CRISPR AACGCTACTCCATTTACAGT AGG Intergenic
No off target data available for this crispr