ID: 1058261309

View in Genome Browser
Species Human (GRCh38)
Location 9:102836097-102836119
Sequence CTGTATATACAAATTATACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058261306_1058261309 0 Left 1058261306 9:102836074-102836096 CCAGCTGAAATTAATTTCCCAAT No data
Right 1058261309 9:102836097-102836119 CTGTATATACAAATTATACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058261309 Original CRISPR CTGTATATACAAATTATACT AGG Intergenic
No off target data available for this crispr