ID: 1058261824

View in Genome Browser
Species Human (GRCh38)
Location 9:102842921-102842943
Sequence ACCGATTTGCAGTCTGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058261822_1058261824 2 Left 1058261822 9:102842896-102842918 CCCAATGACTGTGTCTGTGACAG No data
Right 1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG No data
1058261823_1058261824 1 Left 1058261823 9:102842897-102842919 CCAATGACTGTGTCTGTGACAGA No data
Right 1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058261824 Original CRISPR ACCGATTTGCAGTCTGTGCA TGG Intergenic
No off target data available for this crispr