ID: 1058262721

View in Genome Browser
Species Human (GRCh38)
Location 9:102856287-102856309
Sequence TTCCTATGGCTTTACTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058262718_1058262721 2 Left 1058262718 9:102856262-102856284 CCACACTTACATTGTATTTCTCT No data
Right 1058262721 9:102856287-102856309 TTCCTATGGCTTTACTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058262721 Original CRISPR TTCCTATGGCTTTACTTTCT GGG Intergenic