ID: 1058263023

View in Genome Browser
Species Human (GRCh38)
Location 9:102860160-102860182
Sequence TGTGGTCATAATTACCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058263018_1058263023 19 Left 1058263018 9:102860118-102860140 CCTTTTTTCAGGGACTTTCTGTT No data
Right 1058263023 9:102860160-102860182 TGTGGTCATAATTACCAGCCAGG No data
1058263022_1058263023 -6 Left 1058263022 9:102860143-102860165 CCATCTGTAACTTGGGATGTGGT No data
Right 1058263023 9:102860160-102860182 TGTGGTCATAATTACCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058263023 Original CRISPR TGTGGTCATAATTACCAGCC AGG Intergenic
No off target data available for this crispr